For rat DRG, in situ hybridization was performed on 10 μm cryosections of the L4 dorsal root ganglia using digoxigenin-labeled antisense riboprobes, as previously described30,38.
In situ hybridization was performed on mouse DRG sections as follows. DRGs L4–L5 were harvested from WT and Serpina3n−/− mice 1 day post-SNI, cryosectioned (10 μm), mounted on Superfrost Plus slides (VWR) and frozen at −80°C until use. A digoxigenin-labeled anti-sense cRNA probe against the floxed exon of Serpina3n was generated by a T7 (Roche) in vitro transcription reaction using a Serpina3n cDNA (5′:ACTGCAGAACACAGAAGATGGCCT3′:TCACCAGCACCATCAATGTCCTTTT). In situ hybridization was performed as previously described39. Following ON hybridization, slides were incubated with Alkaline phosphatase conjugated anti-digoxigenin antibody (Roche, 1:200) for 1 h at RT. After several washes in PBST, slides were incubated in NBT/BCIP chromogenic substrate (Roche) according to manufacturer’s specifications for 5 h. Slides were coverslipped and brightfield images were captured on a Nikon 80i Upright Microscope.
In situ hybridization was performed on mouse DRG sections as follows. DRGs L4–L5 were harvested from WT and Serpina3n−/− mice 1 day post-SNI, cryosectioned (10 μm), mounted on Superfrost Plus slides (VWR) and frozen at −80°C until use. A digoxigenin-labeled anti-sense cRNA probe against the floxed exon of Serpina3n was generated by a T7 (Roche) in vitro transcription reaction using a Serpina3n cDNA (5′:ACTGCAGAACACAGAAGATGGCCT3′:TCACCAGCACCATCAATGTCCTTTT). In situ hybridization was performed as previously described39. Following ON hybridization, slides were incubated with Alkaline phosphatase conjugated anti-digoxigenin antibody (Roche, 1:200) for 1 h at RT. After several washes in PBST, slides were incubated in NBT/BCIP chromogenic substrate (Roche) according to manufacturer’s specifications for 5 h. Slides were coverslipped and brightfield images were captured on a Nikon 80i Upright Microscope.