Total RNA was extracted from cells using TRIZOL Reagent (Invitrogen) following the instruction. RNA was converted to cDNA using M-MLV Reverse Transcriptase (Promega) with random primers. The cDNAs were quantified using SsoFast EvaGreen Supermix (Bio-Rad) and Bio-Rad iCycler iQ5 Real-Time PCR systems. Primer sequences for quantifying cDNAs were as follows: BST-2 (sense: CTGCAACCACACTGTGATG, antisense: ACGCGTCCTGAAGCTTATG)19 (link), GAPDH (sense: GTCCACTGGCGTCTTCACCA, antisense: GTGGCAGTGATGG CATGGAC). Level of GAPDH mRNA was used as an internal control to normalize the level of BST-2 mRNA.
Icycler iq5 real time pcr
Manufactured by Bio-Rad
The iCycler iQ5 Real-Time PCR Detection System is a laboratory instrument designed for the amplification and detection of nucleic acid sequences using the real-time polymerase chain reaction (PCR) technique. The system provides precise temperature control and optical detection capabilities for quantitative analysis of DNA and RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
M mlv reverse transcriptase, by Promega (2 mentions)
Ssofast evagreen supermix, by Bio-Rad (2 mentions)
96 well pcr plate, by Bio-Rad (1 mentions)
Sypro orange dye, by Thermo Fisher Scientific (1 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
Primescript reverse transcriptase, by Takara Bio (1 mentions)
4 protocols using icycler iq5 real time pcr
1
Quantifying BST-2 and GAPDH mRNA Levels
2
Thermal Stability Analysis of PaTrmD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The thermal stability analysis
of PaTrmD was performed in a 96-well PCR plate (Bio-Rad)
with 50 μL per reaction containing 5× SYPRO Orange dye
(Invitrogen), 4 μM test protein, and the test ligand(s) at various
concentrations. The assay buffer (50 mM Tris-HCl pH8, 150 mM NaCl,
1 mM MgCl2, 1 mM DTT, and 0.05% Tween-20) was added instead of the
test ligand as a negative control. The temperature was increased from
25 to 95 °C in an i-Cycler iQ5 real-time PCR (Bio-Rad). The thermal
stability curve and the temperature midpoint Tm for the protein-unfolding transition was analyzed using the
Bio-Rad iQ5 software.
of PaTrmD was performed in a 96-well PCR plate (Bio-Rad)
with 50 μL per reaction containing 5× SYPRO Orange dye
(Invitrogen), 4 μM test protein, and the test ligand(s) at various
concentrations. The assay buffer (50 mM Tris-HCl pH8, 150 mM NaCl,
1 mM MgCl2, 1 mM DTT, and 0.05% Tween-20) was added instead of the
test ligand as a negative control. The temperature was increased from
25 to 95 °C in an i-Cycler iQ5 real-time PCR (Bio-Rad). The thermal
stability curve and the temperature midpoint Tm for the protein-unfolding transition was analyzed using the
Bio-Rad iQ5 software.
3
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells indicated in Fig. 1 using TRIzol reagent (Invitrogen, Thermo Fisher Scientific). First-strand cDNAs were synthesized using PrimeScript reverse transcriptase (TaKaRa) and oligo-(dT) according to the manufacturer’s instructions. Quantitative real-time PCR was performed on an iCycler iQ5 Real Time PCR (Bio-Rad Laboratories, Hercules, CA) machine using iQ SYBR Green Supermix (Bio-Rad Laboratories). All qRT-PCR assays were performed in triplicate in at least three independent experiments. Relative expression levels of each target gene were normalized to the GAPDH level. The primers used in the present study are listed in Supplementary Table 2 .
4
Quantitative Analysis of BST-2 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIZOL Reagent (Invitrogen). RNA was converted to cDNA using M-MLV Reverse Transcriptase (Promega) with random primers. The cDNAs were quantified using SsoFast EvaGreen Supermix (Bio-Rad) and Bio-Rad iCycler iQ5 Real-Time PCR systems. Primer sequences for cDNAs were as follows, BST-2 sense: CTGCAACCACACTGTGATG, antisense: ACGCGTCCTGAAGCTTATG [37 (link)], GAPDH sense: GTCCACTGGCGTCTTCACCA, antisense: GTGGCAGTG ATGGCATGGAC [35 (link)]. GAPDH mRNA was quantified in order to normalize the level of bst-2 mRNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!