Neutrophils were seeded in a density of 2 × 105 cells per well in a 48-well suspension cell plate (Greiner bio-one) containing poly-L-lysin (0.01%, Sigma, St. Louis, MO, USA) coated glass coverslips. Cells were stimulated with either 25 nM Phorbol-12-myristat-13-acetate (PMA, Sigma), 10 mM Methyl-β-cyclodextrin (Sigma) for murine NET assays, 10 mM and 20 mM Methyl-β-cyclodextrin for human NET assays, Simvastatin 10 µM (Sigma), Mevastatin 50 µM (Sigma), or RPMI 1640 without phenol red as control, for 3 h under normoxia (18–21% O2) or hypoxia (1% O2) in a hypoxia glove box (COY Laboratories). After incubation, plates were shortly centrifuged for 5 min at 370× g, to bring down cells and NETs onto the coverslip. Finally, the cells were fixed with paraformaldehyde (PFA) at 4% final concentration for 15 min at RT and afterward stored at 4 °C until immune fluorescence staining.
Methyl β cyclodextrin
Manufactured by Merck Group
Sourced in United States, Germany, Japan, United Kingdom
Methyl-β-cyclodextrin is a cyclic oligosaccharide compound commonly used as a laboratory reagent. It is a derivative of the natural compound β-cyclodextrin, with methyl groups attached to the hydroxyl groups. Methyl-β-cyclodextrin has the ability to form inclusion complexes with various organic molecules, which can be utilized in various applications involving solubilization, stabilization, and delivery of compounds in research and development settings.
Automatically generated - may contain errors
Lab products found in correlation
Chlorpromazine, by Merck Group (21 mentions)
Cytochalasin d, by Merck Group (16 mentions)
Nystatin, by Merck Group (15 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (15 mentions)
Dynasore, by Merck Group (14 mentions)
Cholesterol, by Merck Group (14 mentions)
Genistein, by Merck Group (13 mentions)
Bafilomycin a1, by Merck Group (10 mentions)
Chloroquine, by Merck Group (10 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (9 mentions)
Pitstop 2, by Abcam (8 mentions)
Filipin, by Merck Group (8 mentions)
Filipin 3, by Merck Group (7 mentions)
Simvastatin, by Merck Group (7 mentions)
Chlorpromazine hydrochloride, by Merck Group (6 mentions)
Nocodazole, by Merck Group (6 mentions)
Dynasore hydrate, by Merck Group (6 mentions)
Wortmannin, by Merck Group (6 mentions)
Bovine serum albumin (bsa), by Merck Group (6 mentions)
2 hydroxypropyl β cyclodextrin, by Merck Group (5 mentions)
233 protocols using methyl β cyclodextrin
1
Neutrophil NET Formation Assay
2
Investigating DMP1 Internalization in hPDLSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hPDLSCs were seeded on glass coverslips in 6-well plates and grown until 60% confluent. The cells were then pretreated for 60 min with inhibitors for the clathrin-mediated pathway, Pitstop 2 (Sigma) and methyl-β-cyclodextrin (Sigma) or no inhibitor. Pitstop 2 and methyl-β-cyclodextrin (Sigma) were used at concentrations of 15 μm and 15 mM, respectively. The cells were treated with rDMP1 for 15 and 30 min then washed with PBS and fixed overnight. Immunocytochemistry was performed as previously described for DMP1 and GRP78.
3
Modulating Cellular Cholesterol Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
methyl-β-cyclodextrin is a water-soluble structure that forms soluble inclusion complexes with cholesterol (Zidovetzki and Levitan, 2007 (link)). To load cells with cholesterol, water-soluble cholesterol (Sigma-Aldrich) packaged inside a methyl-β-cyclodextrin ring structure was added to purified CLL cells at a concentration of 15 μM. To strip cholesterol from cell membranes, empty methyl-β-cyclodextrin (Sigma-Aldrich) was added at a concentration of 0.5 mM.
4
Endotoxin-Depleted House Dust Mite Extract Protocol
5
Targeting BRAF, NRAS, and cKIT Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The BRAF inhibitor Dabrafenib, used for BRAF mutated cells, and the MEK inhibitor Pimasertib, used for NRAS mutated cells, were from Selleck Chemicals (Houston, TX, USA). The tyrosine kinase inhibitor Dasatinib, used for cKIT mutated cells, was from Bristol-Myers (New York, NY, USA). Bufalin was from PhytoLab (Vestenbergsgreuth, Germany). Methyl-β-cyclodextrin is from Merck (Burlington, MA, USA).
6
Extraction and Characterization of Silk Sericin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Silk sericin (S) was extracted from the cocoons of Bombyx mori that were mechanically isolated from the silkworms, which were kindly supplied by a local small–scale experimental breeding center. Trehalose dihydrate (T), methyl–β–cyclodextrin (M) and commercial sericin (c_S) were purchased from Merck Life Science (Milan, Italy). All other materials were of analytical grade and used as received.
7
Quantifying Cellular Cholesterol Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure cellular cholesterol, 1.5 × 105 HeLa cells/well were cultured in complete medium for 24 h using 6-well culture plates (TPP), and then treated in serum-free medium with 10 ng/ml 27-hydroxycholesterol, 10 ng/ml 25-hydroxycholesterol, 1 mM methyl-β-cyclodextrin (Merck) or 10 µM atorvastatin for 24 h. The cells were then washed twice with PBS, collected in 200 µl/well cholesterol assay buffer (Thermo Fisher Scientific), and stored at -20⁰C. Cellular cholesterol was measured using the Amplex Red Cholesterol Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Cholesterol concentrations were normalized to total protein concentrations, measured using a DC protein assay (Bio-Rad Laboratories, Hercules, CA, United States), as described previously (18 (link), 29 (link)). The inter- and intra-assay coefficients of variation for the cholesterol assay were < 5% and < 6% respectively.
8
Fluorescent DNA Internalization Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using a pcDNA3.1/Zeo(+) vector (Thermo Fisher Scientific, Waltham, MA, USA) as a template, a 2‐kilo base pairs (kbp) DNA fragment was amplified by polymerase chain reaction (PCR) using the following primers: sense: 5′‐TAATACGACTCACTATAGGG‐3′ and anti‐sense: 5′‐CTAGAGGTCGACGGTATACAG‐3′. In some experiments for detection of internalized DNA, the DNA fragment was fluorescently labeled using ChromaTide AlexaFluor 488‐5‐dUTP (Thermo Fisher Scientific). Other reagents were purchased as follows: cytochalasin D from Fujifilm Wako Chemical, methyl‐β‐cyclodextrin from Merck (Kenilworth, NJ, USA), Dynasore and shikonin from Adipogen Life Sciences (San Diego, CA, USA), chloroquine and RU.521 from Invivogen (San Diego, CA, USA) and human BD Fc block from BD Biosciences (San Jose, CA, USA).
9
Evaluating Particle Uptake Mechanisms in RAW 264.4 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RAW 264.4 cells were cultured as mentioned previously. To study the effect of serum on the uptake of particles, the media were removed from the wells, and cells were washed once with PBS and re-suspended in media without serum (incomplete media). Particles were added to the wells and co-incubated with cells for 120 min and their uptake analyzed by flow cytometry as described previously.
To study the effect of inhibitors on the uptake of the particles, after adherence, cells were treated with different pharmacological endocytic inhibitors for one hour at following concentrations: chlorpromazine hydrochloride (20 µM) which blocks clathrin mediated uptake, nystatin (10 µM) which blocks caveolae mediated uptake, methyl-β-cyclodextrin (10 mM) which is believed to affect both clathrin and caveolae mediated uptake, cytochalasin D (1 µM) which inhibits actin polymerization and affects macropinocytosis, and nocodazole (10 µM) which inhibits microtubule assembly (all chemicals from Merck). After this preincubation of cells with inhibitors, particles were added and incubated for 120 min, following which the samples were prepared for flow cytometry as mentioned previously.
To study the effect of inhibitors on the uptake of the particles, after adherence, cells were treated with different pharmacological endocytic inhibitors for one hour at following concentrations: chlorpromazine hydrochloride (20 µM) which blocks clathrin mediated uptake, nystatin (10 µM) which blocks caveolae mediated uptake, methyl-β-cyclodextrin (10 mM) which is believed to affect both clathrin and caveolae mediated uptake, cytochalasin D (1 µM) which inhibits actin polymerization and affects macropinocytosis, and nocodazole (10 µM) which inhibits microtubule assembly (all chemicals from Merck). After this preincubation of cells with inhibitors, particles were added and incubated for 120 min, following which the samples were prepared for flow cytometry as mentioned previously.
10
Optimized IVF Media Protocols
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!