Genomic DNA was extracted from two first-generation adult mites per fruit, each representing an experimental sample. For this, the DNeasy Blood & Tissue (QIAGEN, Germantown, MD, USA) kit was used following the manufacturer’s instructions. A fragment of the gene COI was amplified using the primers DNF (TGA TTT TTT GGT CAC CCA GAA G) and DNR (TAC AGC TCC TAT AGA TAA AAC) [24 ]. PCR reactions were done in a 25 μL reaction volume containing 2.5 μL of buffer 10X (600 mM Tris-SO4 (pH 8.9), 180 mM ammonium sulphate), 1 mM of MgCl2, 0.2 μM of each primer, 0.2 mM of dNTP’s, 0.5 μL of Taq DNA polymerase (Quiagen, GmbH, Hilden, Germany) and 5 μL (approx. 20 ng) of DNA. PCR amplifications were done using a MyCycler (BIO-RAD Laboratories Inc., Hercules, CA, USA). Thermal conditions used were as follows: one cycle of 4 min at 94°C, followed by 35 cycles of 60 s at 94°C, 60 s at 54°C and 60 s at 72°C with a final extension at 72°C for 5 min. PCR products were visualized on 1% agarose gels in 1X TAE. GelPilot 100 bp Plus (QIAGEN, GmbH, Hilden, Germany) size markers were used. The gels were stained with ethidium bromide (0.1 μg mL–1) and photographed. All PCR products were sent to the company Macrogen Inc. (South Korea) for direct sequencing.
Taq dna polymerase
Manufactured by Qiagen
Sourced in Germany, United States, Canada, China, Sweden, United Kingdom, Spain, Australia
Taq DNA polymerase is a thermostable enzyme derived from the bacterium Thermus aquaticus. It is widely used in polymerase chain reaction (PCR) techniques for the amplification of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Pcr buffer, by Qiagen (24 mentions)
Aligner version 3, by CodonCode (21 mentions)
Aligner software, by CodonCode (18 mentions)
Trizol reagent, by Thermo Fisher Scientific (17 mentions)
Qiaquick pcr purification kit, by Qiagen (14 mentions)
Rneasy mini kit, by Qiagen (14 mentions)
S1000 thermal cycler, by Bio-Rad (13 mentions)
Qiaamp dna mini kit, by Qiagen (11 mentions)
Qiaprep spin miniprep kit, by Qiagen (9 mentions)
Abi prism dye terminator cycle sequencing kit, by Thermo Fisher Scientific (8 mentions)
Instagene matrix solution, by Bio-Rad (8 mentions)
Iproof proofreading dna polymerase, by Bio-Rad (8 mentions)
3730xl dna analyzer 96 capillary sequencer, by Thermo Fisher Scientific (8 mentions)
Ampure xp kit, by Beckman Coulter (7 mentions)
Q solution, by Qiagen (6 mentions)
Abi 310 automated dna sequencer, by Thermo Fisher Scientific (6 mentions)
Dna modifying enzymes, by Thermo Fisher Scientific (6 mentions)
Pmd18 t cloning vector, by Takara Bio (6 mentions)
Aligner software version 3, by CodonCode (6 mentions)
Geldoc system, by Clinx (5 mentions)
280 protocols using taq dna polymerase
1
Genomic DNA Extraction and COI Gene Amplification for Mite Analysis
2
Gut Microbiome Isolation and Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An aliquot of 250 μl PBS/turgitol was added to each tube containing the dissected guts. Each tube was disrupted in a FastPrep FP120 instrument (Qbiogene) for 45 s, five times. 50 μl aliquots of neat suspension, 1:200 dilution and 1:4000 dilution were plated on LB media (LMM0202, Formedium), Reinforced Clostridia Agar (27,546, Sigma Chemicals), and MacConkey media (212,123, Difco). The plates were incubated for 24–48 h at 30 °C in aerobic conditions on LB and MacConkey media and in anaerobic conditions on Reinforced Clostridia Agar.
Each isolate was identified using 16S colony PCR with alkaline PEG reagent using 63f and 1389r primers and Taq DNA polymerase (28,104, Quiagen) [27 (link)]. DNA was sequenced using a BigDye v3.1 kit (Applied Bioscience) in a 10 μL reaction volume. The PCR products were sent to The Genome Analysis Centre (Earlham Institute, Norwich, UK) for processing. The sequences were trimmed to remove poorly recognized bases and run through the blastn algorithm (http://blast.ncbi.nlm.nih.gov/Blast.cgi ) against the “Nucleotide collection (nr/nt)” database. Bacteria were identified if the sequence was ≥97% similar to 16S RNA gene in the database and had an e-value close or equal to 0.
Each isolate was identified using 16S colony PCR with alkaline PEG reagent using 63f and 1389r primers and Taq DNA polymerase (28,104, Quiagen) [27 (link)]. DNA was sequenced using a BigDye v3.1 kit (Applied Bioscience) in a 10 μL reaction volume. The PCR products were sent to The Genome Analysis Centre (Earlham Institute, Norwich, UK) for processing. The sequences were trimmed to remove poorly recognized bases and run through the blastn algorithm (
3
Nuclear Inheritance Analysis in Fungal Crosses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to assess the nuclear inheritance in single spores and monosporal cultures both arising from crossed-isolates, two previously designed and used nuclear markers were tested, locus BG112 [5 (link), 38 ] and locus BG62 [37 (link)] (see Additional file 4 ). PCR reactions were carried in 25 μl, using Taq DNA Polymerase (Quiagen, Canada) with final primers concentration at 0.5 μM, dNTP concentration at 0.2 mM and approximately 2.5 ng of DNA. PCR products were separated in a 20 cm long, 7 % acrylamide gel using DCode Universal Mutation Detection System (Bio-Rad, Canada). Gels were run at 100 vts, 18 h for marker BG112 and 15 h for marker BG62, then stained in a SybrSafe bath for 40 min and visualized in a Gel Doc XR System (Bio-Rad, Canada) (see Additional file 5 ).
4
Quantifying AtAzg2 Gene Expression in Arabidopsis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the expression of the AtAzg2, total RNA from different organs of Arabidopsis thaliana were isolated from 100 mg tissue using the TRIzol reagent (Gibco-BRL). RNA was converted into first strand cDNA using the SuperScriptII Reverse Transcriptase (Invitrogen). PCR reactions were conducted in a final volume of 10 ul using 1 ul of the transcribed product and Taq DNA polymerase (Quiagen). The pairs of primers used were Azg2-SmaI-F and Azg2-XhoI-R.
Amplification conditions were as follows: 3 min denaturation at 94°C; 35 cycles at 94°C for 30 s, 53°C for 40 s and 72°C for 30 s, followed by 5 min at 72°C. As control, the Actin2 gene was amplified by 28 cycles and the following primers were used: Actin2-F (5´-TGTACGCCAGTGGTCCTACAACC-3´) and Actin2-R (5´-GAAGCAAGAATGGAACCACCG-3´).
Amplification conditions were as follows: 3 min denaturation at 94°C; 35 cycles at 94°C for 30 s, 53°C for 40 s and 72°C for 30 s, followed by 5 min at 72°C. As control, the Actin2 gene was amplified by 28 cycles and the following primers were used: Actin2-F (5´-TGTACGCCAGTGGTCCTACAACC-3´) and Actin2-R (5´-GAAGCAAGAATGGAACCACCG-3´).
5
SVA Insertion Boundary Mapping
6
Molecular Characterization of PfHRP2 and PfHRP3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted using QIAamp DNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Individual PCRs targeting P. falciparum 18S rRNA, pfhrp2 (exon 2) and pfhrp3 (exon 2) were performed as described previously (Table S1 )17 (link),43 (link). Briefly, 1 µl of DNA template was added into a master mix containing 1 × PCR buffer (Qiagen, Hilden, Germany), 200 µM of each dNTP, 1 unit of Qiagen Taq DNA polymerase (Qiagen, Hilden, Germany), and 100 nM of each primer in a total volume of 20 µl. Genomic DNA of three P. falciparum strains was used as controls, namely 3D7 (pfhrp2+ and pfhrp3+), Dd2 (pfhrp2− and pfhrp3+) and Hb3 (pfhrp2+ and pfhrp3−).
pfhrp2 and pfhrp3 PCR products were purified using SephadexTM G-50 fine DNA grade (GE Healthcare, Buckinghamshire, UK) and sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) according to the manufacturer’s instructions. PCR products were sequenced in the forward and reverse direction. DNA sequence chromatograms were visually inspected to resolve discordant base-calling. BioEdit (http://www.mbio.ncsu.edu/BioEdit/bioedit.html ) was used to assemble the nucleic acid sequences using P. falciparum 3D7 pfhrp2 (PF3D7_0831800) and pfhrp3 (PF3D7_1372200) DNA sequences as the references as well as deduce amino acid sequences of PfHRP2 and PfHRP3.
pfhrp2 and pfhrp3 PCR products were purified using SephadexTM G-50 fine DNA grade (GE Healthcare, Buckinghamshire, UK) and sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) according to the manufacturer’s instructions. PCR products were sequenced in the forward and reverse direction. DNA sequence chromatograms were visually inspected to resolve discordant base-calling. BioEdit (
7
Genetic Analysis of IRS1 PI3K-Binding Sites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated using a Macherey-Nagel extraction kit. Genetic analysis
of DNA covering PI3K-binding sites of IRS1 was performed by PCR. The following
primers were used: Primer 1/1 (forward, 5’ggaggtgg cagtggaggccgactgcc3’;
reverse, 5’cctcagggccgtagtagcag tc3’) Primer 1/2(forward,
5’ctggagcccagccttccacatc3’; reverse, 5’ccctgggcaggctcacctcctc3’). PCR was
performed in a total volume of 25 μL, containing 1x Qiagen Taqpolymerase buffer (Qiagen, Germany), 2 mM MgCl2, 6 mM dNTPs, 0.5 μM
of each primer, 0.2 units Qiagen Taq DNA polymerase and 50 ng
genomic DNA. PCR conditions were 5 min at 94 °C, followed by 35 cycles of 94 °C
for 30 s, 58 °C for 1 min, 72 °C for 45 s, and one step of 72 °C for 10 min. PCR
products were purified using a PCR Purification Kit (Invitrogen Carlsbad, CA),
and the Big dye-terminator sequencing kit (Applied Biosystems, Foster City, CA)
was used during amplification. Sequencing fragments were analysed by using an
ABI Prism 3130 DNA analyzer (Applied Biosystems). Sequence chromatograms were
analyzed by Finch TV.
of DNA covering PI3K-binding sites of IRS1 was performed by PCR. The following
primers were used: Primer 1/1 (forward, 5’ggaggtgg cagtggaggccgactgcc3’;
reverse, 5’cctcagggccgtagtagcag tc3’) Primer 1/2(forward,
5’ctggagcccagccttccacatc3’; reverse, 5’ccctgggcaggctcacctcctc3’). PCR was
performed in a total volume of 25 μL, containing 1x Qiagen Taqpolymerase buffer (Qiagen, Germany), 2 mM MgCl2, 6 mM dNTPs, 0.5 μM
of each primer, 0.2 units Qiagen Taq DNA polymerase and 50 ng
genomic DNA. PCR conditions were 5 min at 94 °C, followed by 35 cycles of 94 °C
for 30 s, 58 °C for 1 min, 72 °C for 45 s, and one step of 72 °C for 10 min. PCR
products were purified using a PCR Purification Kit (Invitrogen Carlsbad, CA),
and the Big dye-terminator sequencing kit (Applied Biosystems, Foster City, CA)
was used during amplification. Sequencing fragments were analysed by using an
ABI Prism 3130 DNA analyzer (Applied Biosystems). Sequence chromatograms were
analyzed by Finch TV.
8
Triplicate PCR Amplification and Pooling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For every DNA extract, a PCR was performed in triplicate in a total volume of 25 µl containing 0.2 mM of each deoxynucleotide triphosphate (dNTP), 1X Qiagen PCR buffer (Qiagen), 0.625 units of Qiagen Taq DNA polymerase (Qiagen), 100 µM bovine serum albumin (BSA), 3 µl of template solution and a forward and reverse primer (Table 2). Amplification was performed using a Veriti thermal cycler (Life Technologies). The temperature profiles of all PCRs are shown in Table 2. For each sample and primer set, all nine PCR products (3 replicate DNA extracts x 3 replicate PCRs), showing bands of the expected size, were pooled and purified using a Nucleofast 96 PCR clean up membrane system (Macherey-Nagel) and Tecan Genesis Workstation 200 (Tecan).
9
Molecular Detection of Coxiella burnetii in Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detection of C. burnetii in blood by end-point PCR was performed using primers and procedures that were modified from previous reports.[9 (link)] The gene target was derived from the transposase gene insertion element IS1111a of C. burnetii isolate LBCE 13265 (NCBI Nr. KT 965031.1). The forward (5’-CGG GTT AAG CGT GCT CAG TAT GTA-3’) and reverse (5’-TGC CAC CGC TTT TAA TTC CTC CTC-3’) primers were synthesized at around 24 bp. The end-point PCR process consisted of an initial denaturation step at 95°C for 15 minutes; 45 cycles of 95°C for 30 seconds, 62°C for 30 seconds, and 72°C for 30 seconds; and a final elongation step at 72°C for 7 minutes. Amplification of 5 μL of DNA was performed in a total volume of 25 μL containing 10X PCR buffer (Qiagen), 2.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primer, and 1 unit of Taq DNA polymerase (Qiagen). Gel electrophoresis was used to separate PCR products on a 2% agarose gel containing ethidium bromide, and visualized using a GelDoc System (Clinx Science Instruments, Shanghai, China).
10
Genotyping Protocol for Mouse DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For genotyping DNA was extracted in accordance with the protocol of genomic DNA isolation kit, XIT for mouse tail (GBiosciences, St. Louis, MO, USA) and for PCR product amplification Taq DNA Polymerase (Qiagen) in combination with gene‐specific oligomer sets were used as follows: sense (Nos1ap) 5′‐TGAAAGTCGAGCTCGGTACC‐3′, antisense (Nos1ap) 5′‐CGTCAGCTGACTAGAGGATC‐3′, sense (tTA) 5′‐CGCTGTGGGGCATTTTACTTTAG‐3′, antisense (tTA) 5′‐CATGTCCAGATCGAAATCGTC‐3′, sense (tTA control) 5′‐CAAATGTTGCTTGTCTGGTG‐3′, antisense (tTA control) 5′‐GTCAGTCGAGTGCACAGTTT‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!