Lipofectamin 3000

Manufactured by Thermo Fisher Scientific

Sourced in United States, China, Germany, France

Lipofectamin 3000 is a cationic lipid-based transfection reagent used for the delivery of nucleic acids, such as DNA and RNA, into mammalian cells. It facilitates the uptake of these molecules by forming lipid-nucleic acid complexes that can be efficiently internalized by the target cells.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Lipofectamin (49 citations) Lipofectamin 3000 reagent (26 citations) Lipofectamin 3000 transfection reagent (16 citations)

138 protocols using lipofectamin 3000

Transfection of Cell Lines for Confocal Microscopy

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For confocal microscopy HT-1080 cells were transfected at 80% confluency with 500 ng DNA using Lipofectamin LTX (Thermo Fisher Scientific) according to the manufacturer's protocol (ratio 1:2 Plasmid:Lipofectamin LTX). HEK293 c18 cells were transfected at 100% confluency corresponding to 1.2*10⁶ cells with 2.5 µg DNA by using Opti-MEM (Thermo Fisher Scientific) and linear polyethylenimine (PEI, Sigma-Aldrich) (ratio 1:3 Plasmid:PEI) (50 (link)) for the secretion assay.
HiPSC-derived cardiomyocytes were transfected using Lipofectamin 3000 (ratio 1:2 Plasmid:Lipofectamin 3,000) (Thermo Fisher Scientific) according to the manufacturer's protocol. Four hours prior transfection the medium was changed to RPMI 1,640 (Thermo Fisher Scientific) supplemented with B-27 (#17504044, Thermo Fisher Scientific) and 10% FBS.
As negative controls only the transfection reagents and Opti-MEM were added to the cells to estimate the effects of cell toxicity due to transfection and are further indicated as non-transfected (NT).

Pohl G.M., Göz M., Gaertner A., Brodehl A., Cimen T., Saguner A.M., Schulze-Bahr E., Walhorn V., Anselmetti D, & Milting H. (2023). Cardiomyopathy related desmocollin-2 prodomain variants affect the intracellular cadherin transport and processing. Frontiers in Cardiovascular Medicine, 10, 1127261.

+ Open protocol

+ Expand

Transfection of Cardiomyocytes and Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

H9c2 and SW-13 cells were split one day before transfection and were cultured in 8-well µSlide chambers (ibidi, Gräfelfing, Germany). Lipofectamin 3000 (Thermo Fisher Scientific) was used according to the manufacturer’s instruction for cell transfection. In total, 250 ng of the plasmid was used per well, and the ratio of Lipofectamin 3000 to plasmid was 3:1.
HiPSC-derived cardiomyocytes were washed with phosphate-buffered saline (PBS) and treated with accutase (Sigma-Aldrich, St. Louis, MO, USA) for 6 min at 37 °C. Afterwards, the cardiomyocytes were resuspended in culture medium and centrifuged at 200x g for 5 min. After resuspension, the cardiomyocytes were cultured in Geltrex-coated µSlide chambers (ibidi). Lipofectamin 3000 (Thermo Fisher Scientific) was used to transfect iPSC-derived cardiomyocytes. The cardiomyocytes were incubated after transfection in µSlide chambers (ibidi) for 24 h.

Brodehl A., Holler S., Gummert J, & Milting H. (2022). The N-Terminal Part of the 1A Domain of Desmin Is a Hot Spot Region for Putative Pathogenic DES Mutations Affecting Filament Assembly. Cells, 11(23), 3906.

+ Open protocol

+ Expand

miR-29b Regulation of NG2 and PDGFRA in Glioblastoma

Cited 4 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

A1207 and U87 cells (2 × 10⁴ per well) were seeded in a 24-well plate. After 24 h, the cells were transfected (HiPerfect, QIAGEN, Hilden, Germany) with 50 nM hsa-miR-29b-3p-5-FAM-labeled (miR-29b-mimic) or with 100 nM hsa-miR-29b-3p inhibitor (miR-29b-inh) (QIAGEN, Hilden, Germany) for 48 h. These concentrations have already been used in other studies.⁷² (link)^,⁷³ ^,⁷⁴ (link) Cells transfected with scrambled-mimic-5-FAM-labeled or scrambled-inhibitor (QIAGEN, Hilden, Germany) served as controls (ctrl), respectively.
For the overexpression of Sp1,⁷⁵ (link) H19,⁷⁶ (link) and c-Myc, (addgene; Watertown, MA, USA) A1207 and U87 cells (4 × 10⁴ per well) were seeded in a 24-well plate. After 24 h, the cells were transfected (Lipofectamin 3000; Thermo Fisher Scientific, Damstadt, Germany) with 250 ng pEF_Sp1, pcDNA_H19, pcDNA_c-Myc or the corresponding control plasmids (ctrl) for 48 h.
For target validation, HEK293 cells were transfected (Lipofectamin 3000) with pGL4, pGL4_NG2-promoter,¹⁹ (link) pGL4_WT-NG2-3UTR, pGL4_MUT-NG2-3UTR, pGL4_WT-PDGFRA-3UTR, or pGL4_MUT-PDGFRA-3UTR (250 ng) and co-transfected with the miR-29b-mimic (50 nM) and pEF_Sp1, pcDNA_H19 or pcDNA_c-Myc (250 ng).

Boewe A.S., Wrublewsky S., Hoppstädter J., Götz C., Kiemer A.K., Menger M.D., Laschke M.W, & Ampofo E. (2024). C-Myc/H19/miR-29b axis downregulates nerve/glial (NG)2 expression in glioblastoma multiforme. Molecular Therapy. Nucleic Acids, 35(1), 102120.

+ Open protocol

+ Expand

HNF4α Overexpression and Knockdown in Hepatic Oval Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HNF4α-overexpression plasmids were constructed by amplifying the HNF4α gene from the rat genome DNA by PCR with the forward primer 5′-ataagcttgacatggacatggctgacta-3′ (HindIII site underlined) and the reverse primer 5′-atggtaccctagatggcttcctgcttgg-3′ (KpnI site underlined). This 1401-bp rat HNF4α gene was inserted into the HindIII/KpnI sites of EGFP-N1 vector (BD Biosciences Clontech, Palo Alto, CA, USA) and confirmed by DNA sequencing, forming a recombinant HNF4α plasmid. The HNF4α plasmids were transfected to hepatic oval cells by Lipofectamin 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Two days post transfection, flow cytometry was used for sorting out EGFP-positive cells according to the method described previously [16 (link)], and the sorted cells were cultured in the presence of G418 (Invitrogen) antibiotic selection at 200 μg/ml for 18 days. HNF4α shRNA and negative control, noneffective shRNA were obtained from Santa Cruz (Dallas, TX, USA) and transfected to hepatic oval cells by Lipofectamin 3000 (Invitrogen) according to the manufacturer’s instructions. Two days post transfection, the cells were selected by Puromycin (Santa Cruz) antibiotic selection at 1 μg/ml for 18 days.

Wang P., Cong M., Liu T., Xu H., Wang L., Sun G., Yang A., Zhang D., Huang J., Sun Y., Zhao W., Ma H., Jia J, & You H. (2017). Inhibitory effects of HNF4α on migration/maltransformation of hepatic progenitors: HNF4α-overexpressing hepatic progenitors for liver repopulation. Stem Cell Research & Therapy, 8, 183.

+ Open protocol

+ Expand

PRRX1 knockdown in BT549 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

BT549 cells were transfected with either control pLKO.1 vector or PRRX1 specific shRNA^{8 (link)} using Lipofectamin 3000 (Invitrogen) following the manufacturer’s instructions. 500,000 cells were seeded in 10 cm plates 24 h prior transfection. Five days post transfection YFP-positive cells were fluorescence-activated cell sorting (FACS) (BD FACSARIA III, USA) sorted directly collected into lysis solution from mirVana^TM miRNA Isolation Kit and subjected to RNA extraction. For LNA transfection, 250,000 BT549 cells were seeded in 6-well plates 24 h prior transfection, and 48 h after transfection cells were lysed for RNA extraction. HEK293 cells were transfected using the same procedure. MDA231 cells were transfected with pCDNA3.1 vectors for miRNA overexpression using Lipofectamin 3000 (Invitrogen) following the manufacturer’s instructions. 200,000 cells were seeded in 6-well plates 24 h prior transfection, and 48 h after transfection cells were lysed for RNA extraction.

Fazilaty H., Rago L., Kass Youssef K., Ocaña O.H., Garcia-Asencio F., Arcas A., Galceran J, & Nieto M.A. (2019). A gene regulatory network to control EMT programs in development and disease. Nature Communications, 10, 5115.

+ Open protocol

+ Expand

Overexpression of Prohibitin 1 in HEK293T

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T/17 cells were seeded into six-well tissue culture plates at a density that allowed approximately 60% confluence to be reached on the day of transfection. The cells were transfected with a eukaryotic expression plasmid containing human prohibitin 1 (pCDH-EF1-FHC_PHB1) in parallel with the empty plasmid vector as a negative control, using Lipofectamin 3000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instruction. Briefly, 2 μg of each plasmid and 5 μl Lipofectamin 3000 were diluted in 125 μl Opti-MEM (Invitrogen) and the mixture of plasmid and reagent was incubated for 20 min at room temperature. Then the DNA-lipid complex was added dropwise into each well of cells along with gentle mixing after which the cells were incubated at optimal conditions. At 24 h post transfection, the culture medium was removed then the cells were further cultured until harvested.

Chumchanchira C., Ramphan S., Paemanee A., Roytrakul S., Lithanatudom P, & Smith D.R. (2024). A 2D-proteomic analysis identifies proteins differentially regulated by two different dengue virus serotypes. Scientific Reports, 14, 8287.

+ Open protocol

+ Expand

Generation of Ferritin Knockout Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The gRNA for FTH was previously used [28] , the gRNA for FTL gene was designed and validated by Feng Zhang's laboratory at the Broad institute. Both gRNAs uniquely target FTH or FTL genes: FTH: GACCATGGACAGGTAAACGT; FTL: GGGACTCACCAGAGAGAGGT.
PSpCas9(BB)-2A-Puro (PX459) V2.0 vector (gift from Feng Zhang, Addgene plasmid #62988) [36] was used for both gRNA. HA22T/VGH were transfected using Lipofectamin3000 (Invitrogen), following the manufacturer's instructions. The cells (2.5 × 10^5) were seeded in 60 mm dish and transfected with 5 μg px459/FTH or px459/FTL using Lipofectamin3000 (Invitrogen), according to the manufacturer's instructions. After 48 h, 1 μg/mL of puromycin (Thermo Scientific) was added and maintained for 72 h. Then the cells were seeded 1 cell per well in a 96-well plate and cultured. Clonal colonies were screened for FTH and FTL expression by ELISA. Genomic alterations were confirmed by Sanger DNA sequencing by BMR Genomics and analyzed in software ChromasLite v2.1. One FTH KO clone was used to generate a double H/L-Ferritin KO clone using px459/FTL.

Asperti M., Bellini S., Grillo E., Gryzik M., Cantamessa L., Ronca R., Maccarinelli F., Salvi A., De Petro G., Arosio P., Mitola S, & Poli M. (2021). H-ferritin suppression and pronounced mitochondrial respiration make Hepatocellular Carcinoma cells sensitive to RSL3-induced ferroptosis. Free radical biology & medicine, 169.

+ Open protocol

+ Expand

Human Lung Cancer Cell Line Culture and Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human A549 lung adenocarcinoma cell line was maintained in DMEM/F-12 medium containing 10% fetal bovine serum, 50 U/ml penicillin, and 0.05 mg/ml streptomycin (all products from Thermo Fisher Scientific) at 37 o C in 5 % CO 2 .
Minigene plasmids were transfected using Lipofectamin 3000 (Invitrogen) with reverse transfection protocol for 24 hours followed by cells harvesting by trypsin-EDTA (Thermo Fisher Scientific). AONs treatment was performed using Lipofectamine RNAiMAX (Invitrogen) on 50-70% confluent cells. It took 48 hours of treatment before cells were harvested. α-amanitin (Sigma) was added at concentrations 1 and 2 ug/mL to 50-70% confluent cells. After 24 hours of treatment, cells were harvested.
In experiments when cells were transfected with minigenes and AONs together, conditions were as follows. Plasmids and AONs were mixed together prior to transfection, and then these mixtures were transfected using Lipofectamin 3000 (Invitrogen) to 50-70% confluent cells. After 24 hours of treatment cells were harvested.
Experiments with α-amanitin and AONs/minigenes treatments were performed next way. Cells were transfected with AONs/minigenes using reverse transfection. After 12-14 hours of transfection media was changed and α-amanitin was added. After 24 hours of α-amanitin treatment cells were harvested.

Kalinina M., Skvortsov D.A., Kalmykova S., Ivanov T., Донцова О.А., & Pervouchine D.D. (2020). Multiple competing RNA structures dynamically control alternative splicing in human ATE1 gene.

+ Open protocol

+ Expand

Viperin Mutant Cloning and Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The coding sequences for human viperin (Genbank accession number AAL50053) or its mutants followed in frame by a glycine-serine spacer and the FLAG_tag sequence (Figure 1) were synthesized and cloned into Nhe I and Not I restriction sites of the pcDNA 3.1 (+) Neo plasmid by Genecust (Luxembourg). The recombinant plasmids were verified by sequencing (Genecust, Luxembourg). Plasmids were transfected in A549 cells using Lipofectamin^TM 3000 according to the manufacturer’s instructions (Thermo Fisher Scientific, Illkirch-Grafenstaden, France).

Vanwalscappel B., Gadea G, & Desprès P. (2019). A Viperin Mutant Bearing the K358R Substitution Lost its Anti-ZIKA Virus Activity. International Journal of Molecular Sciences, 20(7), 1574.

+ Open protocol

+ Expand

Immortalization of Cells via hTERT

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transfected with pBABE-hTERT-Puro (Counter et al., 1998 (link)) using Lipofectamin^TM 3000 (Thermo Scientific) following the manufacturer’s protocol. Cell selection occurred after 48 h when transfected cells were placed under selective pressure by adding 2 μg/ml puromycin (Sigma-Aldrich, Germany) for 4 weeks. The cells were transferred and cultured in DMEM supplemented with 10% FBS and a 1% penicillin-streptomycin antibiotic mixture (Gibco) at 37°C and 5% CO₂. Cells were frozen overnight at −80°C in DMEM containing 20% FBS and 10% dimethyl sulfoxide, without antibiotics, and then stored in liquid nitrogen. Before use, the cells were rapidly thawed in a water bath at 37°C.

Le Q.V., Youk S., Choi M., Jeon H., Kim W.I., Ho C.S, & Park C. (2022). Development of an Immortalized Porcine Fibroblast Cell Panel With Different Swine Leukocyte Antigen Genotypes. Frontiers in Genetics, 13, 815328.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!