Ecodye

The ability of tranylcypromine to regulate proinflammatory cytokine levels induced by LPS was assessed in BV2 microglial cells. After pretreatment with tranylcypromine (5 μM) or vehicle (1% DMSO) for 30 min, the cells were treated with LPS (1 μg/mL) or PBS for 5.5 h. A Superscript cDNA Premix Kit II with oligo dT primers (GeNet Bio, Daejeon, Korea) was used to obtain cDNA by reverse transcription of total RNA extracted using TRIzol (Ambion, Life Technologies, Carlsbad, CA, USA). The cDNA was then used as the template in RT-PCR using Prime Taq Premix (GeNet Bio). RT-PCR was performed as previously described [25 (link)] using the following primers: IL-1β: forward (F)′, AGC TGG AGA GTG TGG ATC CC, and reverse (R)′, CCT GTC TTG GCC GAG GAC TA; IL-6: F′, CCA CTT CAC AAG TCG GAG GC, and R′, GGA GAG CAT TGG AAA TTG GGG T; IL-18: F′, TTT CTG GAC TCC TGC CTG CT, and R′, ATC GCA GCC ATT GTT CCT GG; COX-2: F′, GCC AGC AAA GCC TAG AGC AA, and R′, GCC TTC TGC AGT CCA GGT TC; iNOS: F′, CCG GCA AAC CCA AGG TCT AC, and R′, GCA TTT CGC TGT CTC CCC AA; GAPDH: F′, CAG GAG CGA GAC CCC ACT AA, and R′, ATC ACG CCA CAG CTT TCC AG. After separation by electrophoresis on 1.2% agarose gels with EcoDye (1:5000, Biofact, Daejeon, Korea), Fusion Capt Advance software (Vilber Lourmat, Eberhardzell, Germany) was used to analyze images of the RT-PCR products.

RAPD analysis was performed on 7-month-old green house in vitro regenerated and maternal (control) C. pilosula plants in order to establish the genetic fidelity of the in vitro regenerated plants. Genomic DNA was extracted from fresh leaf tissue (100 mg) of both the in vitro regenerated plants (3) and the maternal plant acquired by randomly picking leaves from each set of plants using a DNeasy Plant Mini Kit (Qiagen, Germany). Prior to further analysis, purified DNA was stored at -20 °C. RAPD amplification was conducted in a reaction volume of 30 µL containing a 10 ng DNA template, 30 pmol of each random primer, and a Solg™ 2X Taq polymerase chain reaction (PCR) Smart-Mix I (Solgent, Daejeon, Korea). The amplification cycle comprised an initial denaturation step at 95 °C for 2 min, followed by 35 cycles of 1 min at 95 °C, 1 min at 42 °C, and 2 min at 72 °C, with a final extension step of 5 min at 72 °C. The amplification products were separated using a 1.5% agarose gel containing Eco Dye (Biofact, Daejeon, Korea). The sizes of the amplification products were obtained through comparison with a 100 bp DNA ladder (Solgent, Daejeon, Korea). The DNA bands in the gel were visualised under the Gel Doc System (Bio-Rad, Hercules, CA, USA) for photography and digitalisation of images.

Total RNAs were subjected to RT-PCR analysis in the determination of mRNA levels of MITF-M, SOX10, CREB, CRTC1, β-catenin or Grb2. Nucleotide sequences of RT-PCR primers are described in Table S1. Briefly, total RNAs were reversely transcribed for 1 h at 42℃ with oligo-dT as the primer (iNtRON, 25087). Single-stranded cDNAs were subjected to 27-40 cycles of PCR using premix kit (Bioneer, K2018). One cycle consisted of denaturation for 30 s at 94℃, annealing for 30 s at 54-60℃, and DNA extension for 1 min at 72℃. RT-PCR products were resolved on agarose gels (iNtRON, 32034) by electrophoresis and stained with EcoDye (Biofact, ES301-1000).

Reverse transcription-polymerase chain reaction was performed to assess the effects of gliquidone on LPS-evoked microglial and astroglial inflammatory cytokine levels. First, total RNA was isolated from BV2 microglial cells or primary astrocytes using QIAzol Lysis Reagent (Qiagen, Cat No. 79306) and reverse transcribed into cDNA. The cDNA was subsequently used as the template in RT-PCR using Prime Taq Premix (GeNet Bio) as previously described with the primers shown in Table 2. The amplicons were separated by electrophoresis on a 1.5% agarose gel containing EcoDye (1:5000, Biofact, Daejeon, South Korea), and images were analyzed using the software Fusion Capt Advance (Vilber Lourmat, Eberhardzell, Germany).

The Maxwell RSC Viral Total Nucleic Purification Kit (Promega, Madison, WI, USA) was used to extract DNA from the blood of wild boars, according to the manufacturer’s instructions. Polymerase chain reaction (PCR) was performed to detect the presence of ASFV DNA, using the ASFV diagnostic primers PPA1 (5′-AGTTATGGGAAACCCGACCC-3′), PPA2 (5′-CCCTGAATCGGAGCATCCT-3′) [28 (link)], P72D (5′-GTACTGTAACGCAGCACAG-3′), and P72U (5′-GGCACAAGTTCGGACATGT-3′), which partially amplified B646L (p72) [17 (link)]. The MGF 360-1La and 360-4L regions of ASFV were detected using the primers MGF 360-1La (F: CCGATTAATGTCAGCCCCCA, R: TGCAGACATCAGCTTTGGGT) and MGF 360-4L (F: CTCTAAGGCACGGTCAAGGT, R: TTCCTCATTTAGATCTTTGGCGT). The cycling protocol comprised an initial step at 95 °C for 2 min, followed by 45 denaturation cycles at 95 °C for 20 s, annealing at 58 °C for 40 s, and extension at 72 °C for 40 s. After the cycling steps, a final extension was performed at 72 °C for 5 min. Electrophoresis was performed using 1.5% agarose gels to visualize the amplification products. The gels were stained with Ecodye (BIOFACT, Seoul, Republic of Korea). Sanger sequencing was performed by Macrogen Inc., an outsourcing service specializing in Sanger sequencing, to determine the nucleotide sequence of the PCR products.