The V2 GeCKO mouse library was propagated as described in (Sanjana et al., 2014 (link)). The sgRNA library readout was performed using a two steps PCR protocol as described in (Chen et al., 2015 (link)). The first PCR (12 cycles) was performed to amplify and preserve full library complexity and the second PCR (16-19 cycles) adds appropriate sequencing adapters to the products from the first PCR. To maintain a 500X library representation, 430 μg of gDNA per condition was PCR amplified. For each 50 μl reaction, 2 μg of genomic DNA was used. The second PCR products were migrated on a 2 % agarose gel, pooled and purified using PureLink quick gel extraction kit (K210012, Invitrogen). The purified libraries were quantified using Kapabiosystems Library Quantification Kit (KK4824, Roche) and sequenced on a HiSeq 2500 (Illumina) according to the manufacturer’s recommendations. All PCR were performed using Phusion Flash High Fidelity Master Mix (F548L; ThermoFisherScientific) according to the manufacturer’s recommendations. PCR primers can be found in (Table S3 ).
Phusion flash high fidelity master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States
Phusion Flash High Fidelity Master Mix is a pre-mixed solution designed for high-fidelity PCR amplification. It contains Phusion DNA Polymerase, dNTPs, and reaction buffer optimized for accurate DNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Hiseq 2500, by Illumina (2 mentions)
Kapa biosystems library quantification kit, by Roche (2 mentions)
Qiaamp dna columns, by Qiagen (2 mentions)
Hiseq 4000 system, by Illumina (2 mentions)
E gel low range quantitative dna ladder, by Thermo Fisher Scientific (2 mentions)
E gel ex, by Thermo Fisher Scientific (2 mentions)
Purelink quick gel extraction kit, by Thermo Fisher Scientific (1 mentions)
Quick rna miniprep kit, by Zymo Research (1 mentions)
Purelink gel extraction kit, by Thermo Fisher Scientific (1 mentions)
Miseq platform, by Illumina (1 mentions)
Miseq machine, by Illumina (1 mentions)
Agencourt ampure xp kit, by Beckman Coulter (1 mentions)
Dneasy powersoil kit, by Qiagen (1 mentions)
Agencourt ampure xp, by Beckman Coulter (1 mentions)
Formic acid, by Merck Group (1 mentions)
Folicur, by Bayer (1 mentions)
Confidor, by Bayer (1 mentions)
Roundup, by Bayer (1 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
16 protocols using phusion flash high fidelity master mix
1
Amplification and Sequencing of CRISPR sgRNA Library
2
Lentiviral Transduction and crRNA Detection
3
Genome-wide CRISPR Screen Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gRNA sequencing and analysis have been previously described (6 (link)). Briefly, genomic DNA from the cells was isolated using QIAamp DNA columns (Qiagen, Hilden, Germany), and gRNA sequences were amplified and barcoded for next-generation sequencing using two-step polymerase chain reaction (PCR). All PCRs were performed using Phusion Flash High-Fidelity Master Mix (Thermo Fisher Scientific, F548L). Sequencing was performed with Illumina HiSeq and 75–base pair single-end reads at the Yale Center for Genome Analysis. Reads were aligned to index sequences using the Bowtie aligner, and a maximum of one mismatch was allowed in the 20–base pair gRNA sequence. The number of uniquely aligned reads for each library sequence was calculated after alignment for each of three biologically independent replicates.
4
Lentiviral Transduction and crRNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
7 days following lentiviral transduction and puromycin selection, genomic DNA was extracted from the cells. PCR amplification of the genomic regions flanking the Nf2 or Trim72 crRNAs was performed using the following primers:
PCR conditions: Using Phusion Flash High Fidelity Master Mix (ThermoFisher), the thermocycling parameters were: 98 °C for 2 min, 35 cycles of (98 °C for 1s, 60 °C for 5s, 72 °C for 15 s), and 72 °C for 2 min.
The PCR amplicons were then used for T7E1 assays following the manufacturer protocol. Statistical significance was assessed by two-sided unpaired Welch’s t-test.
PCR conditions: Using Phusion Flash High Fidelity Master Mix (ThermoFisher), the thermocycling parameters were: 98 °C for 2 min, 35 cycles of (98 °C for 1s, 60 °C for 5s, 72 °C for 15 s), and 72 °C for 2 min.
The PCR amplicons were then used for T7E1 assays following the manufacturer protocol. Statistical significance was assessed by two-sided unpaired Welch’s t-test.
5
Genome-wide CRISPR Screening Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA isolation from both sorted and unsorted cell pellets was performed using QIAamp DNA columns (Qiagen, Hilden, Germany), and gRNA sequences were amplified in a two-step polymerase chain reaction (PCR): For the first PCR, the amount of input genomic DNA for each sample was calculated to achieve 160× coverage of the hGeCKOa and hGeCKOb libraries; a second PCR was performed to attach Illumina adapters and barcodes for next-generation sequencing. All PCRs were performed using Phusion Flash High Fidelity Master Mix (Thermo Fisher Scientific, F548L). Sequencing was performed with Illumina HiSeq and 75–base pair (bp) single-end reads at the Yale Center for Genome Analysis. Primers and barcode sequences are listed in table S5. Reads were aligned to index sequences using the Bowtie aligner, and a maximum of one mismatch was allowed in the 20-bp gRNA sequence. The number of uniquely aligned reads for each library sequence was calculated after alignment for each of three biologically independent replicates.
6
Monitoring fimH Mutations by Sanger Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The evolution of frequency of the identified mutations in fimH was performed using Sanger sequencing analysis of PCR products centered on the fimH region using the following oligonucleotides—oligo up: AGGATGACAGTGGCAACACA and oligo down: GTTTTGGCTTTTCGCACAAT. Small aliquots of the glycerol stocks corresponding to each positive selection cycle were diluted in water and used for PCR reaction (Thermo Phusion flash high-fidelity master mix). The PCR products were sent to Eurofins for purification and Sanger sequencing. The frequency of the mutations was calculated using QSVanalyzer (Carr et al. 2009 (link)), with a cutoff that does not allow detection of mutations lower than 5% frequency.
7
Interferon Induction in Mouse and Monkey Cells
8
Genome-wide CRISPR Screening Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To prepare libraries for sequencing, 430 μg of extracted genomic DNA per sample were amplified and prepared for sequencing using Phusion Flash high-fidelity master mix (Thermo Fisher F548L) according to a previously described protocol (Chen et al. 2015 (link)). A two-step PCR reaction was employed to first amplify the sgRNA cassette and maintain library complexity (12 cycles), and a second PCR reaction was performed to add barcodes and Illumina adapters (16 cycles). Reactions were pooled after each PCR. Following the second PCR, reaction products were run on a 2.5% agarose gel and the DNA purified using a gel extraction kit (PureLink gel extraction kit; Invitrogen K210012). Once purified, the concentration of individual libraries was quantified using the Kapa Biosystems library quantification kit (Roche KK4824) according to kit instructions. Libraries were sequenced using an Illumina HiSeq 2500. The sequencing results were analyzed using the MAGeCK-VISPR pipeline (Li et al. 2015 (link)). For CRISPR score analyses of aligned and normalized read counts, the following formula was used: CRISPR score = log2 (final sgRNA abundance/initial sgRNA abundance) (Wang et al. 2015 (link)).
9
Targeted CRISPR-Cpf1 Mutagenesis Profiling
10
Yeast Transformation and Genetic Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Yeast transformations and co-transformations were carried out using the standard lithium acetate transformation protocol [76 (link)] in the BY4741 genetic background (MATa; his3∆1; leu2∆0; met15∆0; ura3∆0). All the PCR amplifications were performed using the Phusion Flash High Fidelity Master mix (Thermo Scientific, USA) according to the manufacturer’s instruction. Primers and gRNAs used for cloning, deletion, allele replacement and CRISPR-Cas9 are listed in Additional file 1: Table S3 –S4 . The yeast strains used for validations in this work are listed in Table 3 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!