Human RGS7 cDNA (NM_001282778) was cloned from HEK293T cDNA using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies, Santa Clara, CA) according to manufacturers’ instructions, using the following forward and reverse primers: tgaccaggatccgccaccatggcccaggggaataattatgggcagaccagc, ggtcagcggccgctcacttatcgtcgtcatccttgtaatctaacaggttagtgctggccc. A FLAG tag was introduced onto the C-terminus of RGS7 during the cloning procedure. PCR products were cloned into the pCDF1-MCS2-EF1-Puro vector via the BamHI and NotI restriction sites. The p.R44C mutation was introduced using fusion PCR site-directed mutagenesis, using the following forward and reverse primers: ggaattcctatttgtacggtcaaaagc, gcttttgaccgtacaaataggaattcc. The p.E383K was introduced into the wild-type using Q5 polymerase (NEB), phosphorylating the PCR product using PNK (NEB) and self ligating it using Quick Ligase (NEB). Primer pairs were: gaaaatatggcaagagtttctgg, ctgaactcttgagggtacttctttaata. The p.V56C, point mutation was introduced into the p.R44C by synthesizing the full vector using Q5 polymerase (NEB), phosphorylating the PCR product using PNK (NEB) and self ligating it using Quick Ligase (NEB). Primer pairs were: GCTTCTCTGGTTCAGACATTGTT, AGCTAGGTATCTTGGAAAGAAAGC.
Quick ligase
Manufactured by New England Biolabs
Sourced in United States
Quick Ligase is a DNA ligase enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in duplex DNA or RNA. It is designed for rapid and efficient DNA ligation reactions.
Automatically generated - may contain errors
Lab products found in correlation
T4 pnk, by New England Biolabs (20 mentions)
T4 ligation buffer, by New England Biolabs (18 mentions)
T4 polynucleotide kinase, by New England Biolabs (14 mentions)
T4 dna ligase, by New England Biolabs (8 mentions)
Qiaquick gel extraction kit, by Qiagen (8 mentions)
Taq dna polymerase, by New England Biolabs (5 mentions)
Cutsmart buffer, by New England Biolabs (5 mentions)
Fastap, by Thermo Fisher Scientific (5 mentions)
Ampure xp bead, by Beckman Coulter (4 mentions)
Wizard sv gel and pcr clean up kit, by Promega (4 mentions)
Quickligation buffer, by New England Biolabs (4 mentions)
Sgrna oligonucleotides, by Integrated DNA Technologies (4 mentions)
Bamhi, by New England Biolabs (4 mentions)
Restriction endonuclease, by New England Biolabs (3 mentions)
Qiaprep spin miniprep kit, by Qiagen (3 mentions)
Lenticrispr v2, by Addgene (3 mentions)
T4 dna polymerase, by New England Biolabs (3 mentions)
Restriction enzyme, by New England Biolabs (3 mentions)
T4 pnk m0201s, by New England Biolabs (3 mentions)
Plenticrispr v2, by New England Biolabs (3 mentions)
121 protocols using quick ligase
1
Cloning and Mutagenesis of RGS7 Protein
2
Radiolabeled Reagents for Molecular Biology
3
Cloning ToxR Periplasmic Domains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequences of the ToxR periplasmic domains from V. vulnificus, V. parahaemolyticus, V. fischeri, V. harveyi, and Photobacterium profundum were identified by using the ToxR periplasmic sequence from V. cholerae (T199-E294). The six ToxR periplasmic domains were codon optimized and synthesized, from 5' to 3', with a NcoI site, a 6xHis N-terminal tag followed by the coding sequence, a BamHI site, all flanked by primer sites to amplify the constructs. The constructs were PCR amplified, cut with the appropriate restriction enzymes, and the digested constructs were purified using a PCR clean up kit (Qiagen). The pET16b plasmid was digested with the same restriction enzymes, treated with CIP (NEB), and purified using a PCR clean up kit (Qiagen). The inserts were ligated into the plasmid using the Quick Ligase (NEB) and the reaction was used to transform DH5α's. Colonies from the transformation were subjected to colony PCR to determine if the plasmids contained an insert of the appropriate size. Then selected colonies were cultured overnight for mini-preps following manufacture instructions (Qiagen). The resulting plasmids were sequence verified using a primer for the T7 promoter.
4
Optimized Adenoviral Construct Engineering
5
Genetic Manipulation Protocols for Pseudomonas
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All plasmids and primers used in genetic manipulations are listed in Supplementary Tables 2 and 3 , respectively. All basic microbiological and molecular procedures were executed according to standard protocols87 . Genomic DNA (gDNA) isolation, plasmid preparation, and DNA gel extraction were performed using nucleotide purification kits purchased from Qiagen or BioBasics. All restriction enzymes, T4 DNA ligase, Quick ligase, Taq DNA polymerase, RNase A, Antarctic phosphatase, and shrimp alkaline phosphatase were purchased from New England Biolabs. Phusion DNA polymerase was purchased from ThermoFisher Scientific. Transformations of P. aeruginosa and P. fluorescens were carried out using established protocols for electroporation88 (link). Site-directed mutagenesis of plasmids was carried out using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). Oligonucleotide primers were purchased from Integrated DNA Technologies. Protein concentrations were measured using the Pierce 660 nm protein assay with the addition of the ionic detergent compatibility reagent (IDCR) when necessary (ThermoFisher Scientific).
6
Cloning and Expressing PeiW Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from M. wolfeii was obtained by extracting with a phenol-chloroform extraction procedure. The gene encoding for PeiW (psiM100p36) was amplified by PCR38 (link) and the sequence of amplified peiW was verified by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany). The insert and the Novagen vector pET-15b (Merck Group, Darmstadt, Germany) were digested with NdeI (NEB, Ipswich, MA, USA) and XhoI (NEB, Ipswich, MA, USA) and ligation of digested peiW and pET-15b with Quick ligase™ (NEB, Ipswich, MA, USA) generated the plasmid pET-15b_peiW, which was transformed into E. coli Top10. The successful transformation was confirmed by a colony PCR and by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany). Plasmid DNA was obtained by extracting with a Miniprep Kit (Pure Yield™, Promega, Madison, WI, USA), and pET-15b_peiW was transformed into E. coli DE3 BL21-AI (Life technologies, Van Allen Way Carlsbad, CA, USA). All plasmids and primers used in this study are listed in Supplementary table 1 and Supplementary table 2 respectively.
7
Cloning and Protein Expression in E. coli
8
Recombinant Expression of GSNOR Enzymes
9
Construct and Validate Dual-Fusion Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The synthetic
gene (IDT Technologies) of ERα (organism, Homo sapiens; gene, ESR1, accession number P03372; residue number, 301–552)
was subcloned with NheI and NotI
restriction sites at the 5′- and 3′-ends into a pSKB3
vector containing an N-terminal maltose binding protein (MBP). The
resulting vector furnished the following amino acid sequence: MASS-(His)6-TEV-MBP-Linker-ERα (where “Linker” =
N10-LGASGSG).
The gene insert coding for the
ice nucleation protein with the NC-terminal fusion (INPNC: fusion
of the N-terminal membrane domain INPN and the C-terminal
extracellular domain INPC) was synthesized by IDT Technologies
with Nco1 and Nhe1 restriction sites
at the 5′- and 3′-sites and was subcloned into the MBP-ERα
pSKB3 vector above. The MBP gene was removed in the process. The resulting
vector encodes for the following amino acid sequence: MAA-INPN-RS-INPC-SSN10LGASGSG-ERα.
The INPNC insert and vector backbone were double digested (NcoI/NheI), heat inactivated at 65 °C
for 15 min, ligated with QuickLigase (NEB) at a 5:1 molar ratio, and
transformed into XL1Blue competent cells. Plating on kanamycin agar
plates yielded individual colonies, which were cultured, DNA purified
(NucleoSpin, MacheryNagel), and sequenced (Quintara BioSciences).
gene (IDT Technologies) of ERα (organism, Homo sapiens; gene, ESR1, accession number P03372; residue number, 301–552)
was subcloned with NheI and NotI
restriction sites at the 5′- and 3′-ends into a pSKB3
vector containing an N-terminal maltose binding protein (MBP). The
resulting vector furnished the following amino acid sequence: MASS-(His)6-TEV-MBP-Linker-ERα (where “Linker” =
N10-LGASGSG).
The gene insert coding for the
ice nucleation protein with the NC-terminal fusion (INPNC: fusion
of the N-terminal membrane domain INPN and the C-terminal
extracellular domain INPC) was synthesized by IDT Technologies
with Nco1 and Nhe1 restriction sites
at the 5′- and 3′-sites and was subcloned into the MBP-ERα
pSKB3 vector above. The MBP gene was removed in the process. The resulting
vector encodes for the following amino acid sequence: MAA-INPN-RS-INPC-SSN10LGASGSG-ERα.
The INPNC insert and vector backbone were double digested (NcoI/NheI), heat inactivated at 65 °C
for 15 min, ligated with QuickLigase (NEB) at a 5:1 molar ratio, and
transformed into XL1Blue competent cells. Plating on kanamycin agar
plates yielded individual colonies, which were cultured, DNA purified
(NucleoSpin, MacheryNagel), and sequenced (Quintara BioSciences).
10
Constructing ERα-Selective Monobody Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene encoding for
the ERα-estradiol selective monobody protein, a sequence adapted
from Koide et al.,19 ,20 (link) was synthesized by IDT Technologies
with BamHI and XhoI restriction
sites at the 5′- and 3′-ends and subcloned into a pSKB3
vector—a variation of Novagen’s pET-28a vector with
the thrombin site exchanged for a TEV proteolysis site. The insert
and vector backbone were double digested (BamHI/XhoI), heat inactivated at 80 °C for 5 min, ligated
with QuickLigase (NEB) at a 5:1 molar ratio, and transformed into
XL1Blue competent cells. Plating on kanamycin agar plates yielded
individual colonies, which were cultured, DNA purified (NucleoSpin,
MacheryNagel), and sequenced (Quintara BioSciences).
the ERα-estradiol selective monobody protein, a sequence adapted
from Koide et al.,19 ,20 (link) was synthesized by IDT Technologies
with BamHI and XhoI restriction
sites at the 5′- and 3′-ends and subcloned into a pSKB3
vector—a variation of Novagen’s pET-28a vector with
the thrombin site exchanged for a TEV proteolysis site. The insert
and vector backbone were double digested (BamHI/XhoI), heat inactivated at 80 °C for 5 min, ligated
with QuickLigase (NEB) at a 5:1 molar ratio, and transformed into
XL1Blue competent cells. Plating on kanamycin agar plates yielded
individual colonies, which were cultured, DNA purified (NucleoSpin,
MacheryNagel), and sequenced (Quintara BioSciences).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!