Primerstar max dna polymerase

We developed specific primers based on the target SNP to verify the transcriptome study of the target SNP of NnADAP by employing the sanger sequence. Simply, different varieties’ DNA was extracted as templates to conduct polymerase chain reaction with Primer STAR Max DNA Polymerase (Takara), 10 uM forward and reverse primers each. The PCR products were then ligated on T-vector for sequencing.

Total RNA from different samples was extracted by Total RNA Extractor (Trizol) (Sangon Biotech, Shanghai, China) and reverse transcribed into cDNA using Hifair^® III; Reverse Transcriptase (Yeasen, Shanghai, China) according to the instruction book.
The RT-PCR was performed using PrimerSTAR MaxDNA Polymerase (TaKaRa, Shiga, Japan), and the appropriate annealing temperature for PCR according to the properties of primer pairs for different genes. The number of amplification reaction cycles in this study was 30. The RT-PCR experiment for each gene was conducted with 3 biological replicates. The PCR products were determined using electrophoresis on the 1% agarose gels. Specific primers for different OsSR genes and the control gene OsActin used for RT-PCR are listed in Table S7.
For the qRT-PCR experiment, SYBR Green qPCR Master Mix (TOROIVD) was used, and the experiment was conducted on LightCycler 480 II (Roche, South San Francisco, CA, USA). The data was analyzed as previously described using OsActin as the internal standard (Livak & Schmittgen, 2001 (link)). The qRT-PCR experiment was carried out using 3 biological replicates, and 3 technical replicates were performed for each biological replicate. The qRT-PCR data was calculated using 2^−ΔΔCT method and Student’s t-test. The primer sequences for qRT-PCR are listed in Table S6.

The ERBB2 3’-UTR fragment containing the predicting miR-1268b binding sites were amplified by PCR using PrimerSTAR Max DNA polymerase (Takara, Japan) and primers: 5’ GCGGA GCTCAACCAGAAGGCCAAGTC 3’ (FORWARD), 5’ GCGTCTAGAAAATGGACAAAGTGGGTGTGG 3’ (REVERSE) designed and synthesized by company of biosune (Jinan, China). The 3’-UTR of ERBB2 were then inserted into the XbaI and SacI sites of pmirGLO target expression vector (Promega, San Luis Obispo, CA, USA.).
Breast cancer cells MDA-MB-231 and MDA-MB-468 (at a density of 5×10^4 per well) were seeded into 24-well plates 12h before transfection. Then, the cells transfected with 1ug of ERBB2 3’UTR fragment reporter vector containing the predicted miR-1268b binging sites, co-transfected with 30nM miR-1268b mimics or negative control using Tuberfect tansfection reagent (Roche, USA). After 48h’ incubation, cells were lysed by PLB (1×,100ul) and were put on an orbital shaker (QILINBEIER, Jiangsu, China) at 100rpm for 30 minutes before placed in -80°C refrigerator overnight. renilla luciferase (internal reference) and firefly luciferase signals were measured using a dual-luciferase reporter assay kit (Promega, Madison, WI, USA.) according to the manufacture’ s instructions.

The lip1 gene from C. rugosa ATCC14830 (JCM9586) was purchased from Japan Collection of Microorganisms (JCM). E. coli DH5α was used for the propagation and construction of a mutagenesis library. P. pastoris GS115 and the plasmid pGAPZαA (Invitrogen, Beijing, China) were the host and constitutive expression vector, respectively. The recombinant plasmid pGAPZαA-lip1 used for saturation mutagenesis was constructed in our lab. PrimerSTAR Max DNA polymerase, restriction endonucleases, and polymerase chain reaction (PCR) reagents were purchased from TaKaRa (Dalian, China). A protein assay kit was purchased from BIOTEKE (Beijing, China). The antibiotic zeocin and Ni-nitrilotriacetate (NTA) were purchased from Invitrogen (Beijing, China) and GE Health (Uppsala, Sweden), respectively. All other chemicals and reagents were of analytical grade from Sigma (Sigma-Aldrich, USA).

Escherichia coli (E. coli) DH5α (Invitrogen, Shanghai, China) and plasmid pET22b (Novagen, Madison, USA) were used as cloning host and vector, respectively. E. coli Rosetta-gami B (Weidi, Shanghai, China) was used for protein expression. PrimerSTAR Max DNA polymerase and the restriction endonucleases EcoRI, XhoI and DpnI were purchased from Takara (Dalian, China). Isopropyl β-_D-1-thiogalactopyranoside (IPTG), BSA standard protein and antibiotic ampicillin were purchased from Sangon (Shanghai, China). Triolein and tricaprylin were purchased from Sigma-Aldrich (Shanghai, China), and trilaurin was purchased from TCI (Shanghai, China). Other reagents were of analytical grade and provided by a local supplier.