Mmessage mmachine

EGFP-3x Myc cDNA mRNA was in vitro transcribed from its cDNA cloned into pSP64 poly(A) using mMESSAGE mMACHINE (ThermoFisher, Waltham, MA). The mRNA was translated in the rabbit reticulocyte lysate system (Promega, Madison, WI) with or without 1 μM (final) MBP or MBP-TRAL proteins. Synthesized EGFP-3x Myc protein and MBP or MBP-TRAL proteins from the reaction were examined by immunoblot with anti-Myc (9E10; Covance, Princeton, NJ) or Anti-MBP antibody (Sigma-Aldrich, St. Louis, MO).

The specificity of MOs was validated by mRNA-mediated rescue of respective phenotypes. Rescue experiments were done by co-injection of capped mRNA (mMESSAGE mMACHINE; ThermoFisher Scientific) and MOs. Transcripts used were pkd2 (ENSDART00000020412) and slc25a25b (ENSDART00000098163).

All human Kv3.2, Kv3.4a, and rat Kv1.2, Kv2.1, Kv3.1, Kv4.2, as well as Drosophila K-Shaw-F335A cDNAs encoding the investigated Kv channels were maintained in appropriate expression vectors suitable for in vitro transcription^{66 (link)}. Site-directed mutagenesis was conducted according to the QuickChange protocol (Stratagene, La Jolla, CA). All chimeras were created by Phusion-based PCR (Thermofisher Scientific), and the primers used are listed in Supplementary Materials, Table S3^{67 (link)}. All mutations were verified by automated DNA sequencing (Genewiz, South Plainfield, NJ). The mRNAs were synthesized with an in vitro RNA transcription kit (mMESSAGE mMACHINE by Ambion, ThermoFisher Scientific) followed by purification before heterologous expression in Xenopus oocytes^{66 (link)}.

Templates for in vitro transcription were amplified by PCR using either Phusion polymerase (NEB) or Pfx (Thermo) with primers M13 forward (5′-GTAAAACGACGGCCAGT-3′) and reverse primers to either exclude or include the TYMV 3′-UTR and the various plasmids described above. The reverse primers used when the TYMV 3′-UTR was included were modified to ensure precise 3′ ends (CC and CCA). Specifically, the two penultimate DNA nucleotides were modified with 2′OMe^{50 (link)} to reduce N + 1 T7 polymerase nucleotide addition. Methylated reverse primers were ordered from GE Dharmacon and IDT. PCR reactions of volume 200–500 µL were conducted, the DNA was purified using the Promega Wizard Kit, and ~1 µg of template was used in T7 in vitro transcription kits mMessage mMachine and MEGAscript (Thermo). RNAs were then purified using the Qiagen RNeasy kit and the concentration was determined using a NanoDrop spectrophotometer (Thermo) at absorbance 260 nm. The quality of the RNA was determined by 8% denaturing PAGE and imaged using ethidium bromide.

Capped mRNA was generated from a linear DNA template in a pCS2+ vector using the mMessage mMachine (ThermoFisher Scientific, Waltham, MA, USA) kit, purified using TRIzol™ (ThermoFisher Scientific, Waltham, MA, USA) and microinjected into the one-cell stage embryo at doses of 5, 15, and 75 pg. The highest 75 pg dose was used for all subsequent experiments unless otherwise stated. All RNA technical replicates were performed on a single day, injecting foxc1 transcripts and control RNA at the same dose into the same clutch of embryos. Morpholino oligonucleotides foxc1a—CCTGCATGACTGCTCTCCAAAACGG—and foxc1b—GCATCGTACCCCTTTCTTCGGTACA—were previously reported [46 (link)].

cDNAs for rat wild type NMDAR subunits GluN1-1a (GenBank U11418, U08261; hereafter GluN1 or GluN1a), GluN1-1b (U08263, hereafter GluN1b), GluN2A (D13211), GluN2B (U11419), GluN2C (M91563), and GluN2D (L31611, modified as described in Monyer et al., 1994 (link)) were provided by Drs. S. Heinemann (Salk Institute), S. Nakanishi (Kyoto University), and P. Seeburg (University of Heidelberg). Site-directed mutagenesis was conducted using the QuikChange kit (Agilent Technologies, Santa Clara, CA) following the recommended protocol. DNA sequencing was used to verify all mutations. The amino acid numbering system started with the initiating methionine as residue number one. For expression in Xenopus laevis oocytes, cDNA constructs were linearized by restriction enzymes, and subsequently used to synthesize in vitro cRNAs following the manufacturer’s protocol (mMessage mMachine, Ambion, ThermoFisher Scientific, Waltham, MA).

pcDNA3-BD2-sfGFP-NLS-polyA was linearized with XhoI and treated with proteinase K. After purification of the linearized template by phenol/chloroform extraction and ethanol precipitation, in vitro transcription was performed using mMESSAGE mMACHINE (Thermo Fisher Scientific). RNA was purified by LiCl precipitation and re-suspended in H₂O.
Before microinjection, zebrafish eggs were dechorionated manually using tweezers. A mixture (∼0.5 nl in PBS) of BD2-sfGFP-NLS mRNA (375 pg) and Cy5-labeled miR430-MO (0.8 pg) was injected into the yolk of 1-cell-stage embryos. Five minutes after mRNA injection, Cy3-labeled Fab specific to H3K27ac was injected (100 pg in ∼0.5 nl). Injected embryos were incubated at 28°C until the 4-cell stage and embedded in 0.5% low-gelling temperature agarose in 0.03% sea salt with animal pole down on a 35-mm glass-bottom dish. Fluorescence images were collected as described above.