Rna micro kit

Five mice per group were immunized with 60 μg ova488, 30 μg αCD40, and 30 μg poly(I:C). About 12–14 days later, mice were killed and draining LNs were digested as described above. Cells were stained with CD45-PE. Cells then underwent negative selection using anti-PE microbeads and LS columns from Milltenyi and sorted on a BD FACsAria II cell sorter (BD Biosciences, San Jose, CA) based on the lack of CD45, PDPN+, CD31+, and fluorescent antigen (Supplementary Fig. 1, bottom). Antigen-positive and antigen-negative cells were run through a QIAshredder (catalog number 79656, Qiagen, Hilden, Germany) before RNA was isolated using an RNA micro kit (catalog number 74004, Qiagen, Hilden, Germany). Complimentary DNA (cDNA) was made using the Qiagen Quantitech Reverse Transcription kit (catalog number 205314, Qiagen, Hilden, Germany). Taqman Primers to CCL20 (Assay ID number Mm01268754_m1) and the control gene, GusB (Assay ID number Mm01197698_m1), were purchased from Thermo Fisher (Waltham, MA) and run on a Thermo Fisher Step 1 plus real-time PCR machine. cDNA was quantified using the delta-delta CT method to establish the fold increase in CCL20 from antigen + LECs compared to antigen-LECs. Experiments were completed three times and five mice per group were pooled for qRT-PCR. An unpaired t-test was used to determine statistical significance.

MCF-7 or U2OS cells were cultured in complete medium [DMEM containing 10% FBS, 4 mM glutamine and penicillin/streptomycin]. After plating 50 000 cells/well in 24-well format, they were left to grow for 16 hours. The medium was then changed to EV-depleted medium and 50 µg/mL of EVs from MDA-MB-468 cells were added. After 48 hours of incubation, RNA was extracted using RNA Micro kit (Qiagen). Real-time PCR was performed on a 7300 Real-Time PCR System (Applied Biosystems), using the iTaq™ SYBR® Green Supermix with ROX (BioRad). 36B4 was used as a reference transcript for normalization. The sequences of the primers are the following: 36B4 FWD 5′ GTGTTCGACAATGGCAGCAT 3′, REV 5′ GACACCCTCCAGGAAGCGA 3′; OCT4 FWD 5′ GACAACAATGAAAATCTTCAGGAG 3′, REV 5′ CTG GCGCCGGTTACAGAACCA 3′; NANOG FWD 5′ CAGCTGTGTGTACTCAATGATAGATTT 3′, REV 5′ ACACCATTGCTATTCTTCGGCCAGTTG 3′, ZEB1 FWD 5′ AAGAATTCACAGTGGAGAGAAGCCA 3′, REV 5′ CGTTTCTTGCAGTTTGGGCATT 3′; SNAIL FWD 5′ CCTCCCTGTCAGATGAGGAC 3′, REV 5′ CCAGGCTGAGGTATTCCTTG 3′. The results are presented as fold change calculated with 2^−ΔΔCt method.

T-cell receptor analysis was performed as described previously (54 (link)), with minor modifications. Briefly, mRNA was isolated with the RNA microkit (Qiagen) according to manufacturer’s protocol. Isolated mRNA was used for cDNA synthesis with 5’RACE template switch technology to introduce a universal primer binding site, and unique molecular identifiers (UMI’s) were added at the 5’ end of the cDNA molecules using the SMARTScribe Reverse Transcriptase (TaKaRa). cDNA synthesis was followed by an AMPure XP bead-based cleanup (Beckman Coulter). Purified cDNA molecules were amplified in two subsequent PCR steps using the Q5^® High-Fidelity DNA Polymerase (New England BioLabs), with an AMPure XP bead-based cleanup in between. PCR products were size selected on gel and purified using the Nucleospin PCR cleanup kit (Machery-Nagel). The PCR products were sequenced via Illumina MiSeq paired end using 2x250 bp sequencing.

mRNA was isolated with the RNA microkit (Qiagen) according to the manufacturer’s protocol. Isolated mRNA was used in the 5’ RACE-based SMARTer Mouse TCR α/β profiling kit (Takara Bio USA, Inc.) to perform sequencing of TCRs, following the manufacturer’s protocol using only the TCRβ-specific primers. Cleanup was performed with AMPURE XP clean-up beads (BD). PCR products were sequenced via Illumina MiSeq paired-end 2 × 300 nucleotide (nt) sequencing.

From freshly isolated PBMC, NK cells were magnetically sorted using a MACS kit (130-092-657, Miltenyi Biotec, Bergisch Gladbach, Germany) according to its instruction. Specific NK cell subsets were electrically sorted using a FACS Aria cell sorter (BD Bioscience). The total RNA was extracted using a RNA micro kit (QIAGEN, Hilden, Germany). From these RNA, complementary DNA were synthesized using reverse transcriptase and ReverTra Ace qPCR Master mix (Toyobo, Osaka, Japan). TaqMan gene expression assays (Applied Biosystems, Foster City, CA) were performed for the following factors: human TRAIL (Assay ID; Hs00366278_m1), Fas ligand (Hs00181225_m1), signal transducer and activator of transcription (STAT)1 (Hs01013996_m1), IFN-γ (Hs00989291_m1) and β-actin (Hs99999903_m1). All of these target gene expression levels were normalized to the human β-actin expression levels.

To assess H19 levels in ischemic stroke patients, peripheral blood samples were drawn from these stroke patients within 3 hours of stroke onset, as well as the healthy controls. All blood samples underwent qRT-PCR to measure H19 levels in serum.
Total RNA in the ischemic patients’ blood serum or the cerebral cortices of penumbra area in MCAO/R rats or OGD SH-SY5Y cells were extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) and further purified with a RNA Micro Kit (Qiagen, Valencia, CA, USA). The following PCR reaction conditions were used when performed in a lightcycler PCR detection system (Roche Diagnostics Ltd., Shanghai, China): 10 min at 95°C, 40 cycles of 10 s at 95°C, 15 s at 60°C, and 20 s at 72°C. Primers for amplification of H19, Id2, and β-actin were synthesized by Invitrogen Life Technologies, and are listed in Table 1. The β-actin gene was used as a reference gene, and relative mRNA expression levels were calculated using the standard 2^−ΔΔCt method.

mRNA was isolated with the RNA microkit (Qiagen) according to the manufacturer’s protocol. Next, the 5′ RACE-based SMARTer Mouse TCR α/β profiling kit (Takara Bio, San Jose, CA, USA, Inc.) was used following the manufacturer’s protocol but only using the TCRβ-specific primers to perform TCR sequencing. The PCR products were cleaned up with AMPURE XP clean-up beads (BD) and sequenced via Illumina MiSeq paired-end 2 × 300 nucleotide sequencing.