Total RNA was isolated from bacterial cells cultured overnight under anaerobic condition by using the RNeasy midi-column (QIAGEN) according to the manufacturer’s instructions. RNA was treated with RNase-free DNase I (Roche) to eliminate DNA contamination. Then, 100 ng RNA was reverse-transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche) with random primers. qRT-PCR was performed in a Roche LightCycler® 1.5 Instrument using LightCycler TaqMan Master (Roche). Primers and probes were designed for selected target sequences using Universal ProbeLibrary Assay Design Center (Roche Applied Science) and are listed in Table 2 . Data were analyzed using the real time PCR software of the Roche LightCycler® 1.5 Instrument. Relative gene expressions were quantified using the comparative threshold cycle 2–ΔΔCT method with 23S rRNA as the endogenous reference.
Lightcycler 1.5 instrument
Manufactured by Roche
Sourced in Germany, United States
The LightCycler 1.5 Instrument is a real-time PCR (Polymerase Chain Reaction) system designed for fast and accurate quantification and detection of nucleic acids. It features a rapid thermal cycler, optical detection system, and intuitive software for data analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (4 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (3 mentions)
Lightcycler faststart dna masterplus sybr green 1, by Roche (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Power sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Rneasy midi column, by Qiagen (2 mentions)
Lightcycler taqman master, by Roche (2 mentions)
Applied biosystems 3500 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Quantitect sybr green pcr kit, by Roche (1 mentions)
Non acetylated bovine serum albumin, by Merck Group (1 mentions)
Syto9, by Thermo Fisher Scientific (1 mentions)
Glycerol, by Merck Group (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Cdna synthesis, by Qiagen (1 mentions)
Rneasy, by Qiagen (1 mentions)
Quantitect sybr green pcr kit, by Qiagen (1 mentions)
Lightcycler 3, by Roche (1 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
28 protocols using lightcycler 1.5 instrument
1
Quantitative Transcriptome Analysis of Anaerobic Bacteria
2
Quantitative RT-PCR Analysis of Bacterial Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from early-exponential-phase grown bacteria cells by use of the RNeasy midi-column (QIAGEN) according to the manufacturer's instructions. RNA was DNase-treated with RNase-free DNase I (MoBioPlus) to eliminate DNA contamination. RNA of 100-ng was reverse-transcribed with the Transcriptor First Strand cDNA Synthesis Kit (Roche) using random primers. qRT-PCR was performed in a Roche LightCycler 1.5 Instrument using LightCycler TaqMan Master (Roche). Primers and probes were designed for selected target sequences using Universal ProbeLibrary Assay Design Center (Roche-applied science) and listed in Table 3 . Data were analyzed using the real time PCR software of Roche LightCycler 1.5 Instrument. Relative gene expressions were quantified using the comparative threshold cycle 2−ΔΔCT method with 23S rRNA as the endogenous reference.
3
Screening and Sequencing of PsuPV1 Viruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA isolates were initially screened with the PsuPV1 type-specific qPCR primer set (APV12-L1-RT-F: 5′-GATCCCAAGCAGACTCAAATG-3′ and APV12-L1-RT-R: 5′-ACCTGCATTAATTTGGTTACAAGG-3′), targeting the 100 bp fragment of the PsuPV1 L1 gene. The PsuPV1 qPCR test was performed using a QuantiTect SYBR Green PCR kit on a LightCycler 1.5 Instrument (Roche Diagnostics, Mannheim, Germany). Samples were considered PsuPV1-positive when showing specific melting peaks at around 77.5 °C. Furthermore, PsuPV1-negative samples were subjected to a highly sensitive broad-range Pi-PV PCR assay that allows the amplification of a 330 bp L1 gene fragment of all currently recognized Pi-PVs.
All Pi-PV PCR products were analyzed using 2% agarose gel electrophoresis. In addition, 16 randomly selected PsuPV1 qPCR and all five Pi-PV PCR–positive products were Sanger sequenced on an Applied Biosystems 3500 Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA) automated sequencing instrument and analyzed using the BLAST algorithm [33 (link)]. All analyses were carried out in line with our previously published protocols [31 (link)].
All Pi-PV PCR products were analyzed using 2% agarose gel electrophoresis. In addition, 16 randomly selected PsuPV1 qPCR and all five Pi-PV PCR–positive products were Sanger sequenced on an Applied Biosystems 3500 Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA) automated sequencing instrument and analyzed using the BLAST algorithm [33 (link)]. All analyses were carried out in line with our previously published protocols [31 (link)].
4
Analyzing gene expression in testes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from testes was extracted with Trizol (Invitrogen). Equal quantity of RNA from each genotype was used to synthetize cDNA with MVL-V reverse transcriptase (Invitrogen). qPCR analyses were performed with LightCycler Fast Start DNA MasterPLUS SYBR Green I and the LightCycler 1.5 Instrument (Roche). The relative expression level of each analysed gene was calculated by 2−ddCt, where ddCt = (Ct target gene-Ct control gene) using CycA as internal control. Primer sequences (5′-3′) for Mst87F: forward, aacttttacgaattaatcatgtgctg; reverse, cagggtccacatcctcctc. dj: forward, aactgaaaaagaaatgcaaggaa; reverse, tttgcaagggtctttcttcg. fzo: forward, caatgtctctccatacccctaca; reverse, agttgccaatcgcaagagtt. twe: forward, aagaccaagtcctggcaatg; reverse, cagtcgtgaacgtgatttcc. CycA: forward, gctggaggagatcacgactt; reverse, ccatcatagccaccttcttgt.
5
Extreme RT-PCR Assay Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For extreme RT-PCR, reactions were performed in 5-μL volumes containing 50 mmol/L Tris (pH 8.3), 3 mmol/L MgCl2, 200 μmol/L of each deoxynucleotide triphosphate (deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate), 500 μg/mL nonacetylated bovine serum albumin (Sigma-Aldrich, St. Louis, MO), 2% (v/v) glycerol (Sigma-Aldrich), 10.0 μmol/L of each primer, 1 U/μL TaqIT DNA polymerase (Enzymatics, Beverly, MA), 2× LunaScript RT Enzyme Mix (New England Biolabs, Ipswich, MA), and 2.5 μmol/L Syto9 (Life Technologies, Carlsbad, CA). Due to the high concentrations of polymerase and primers, reactions were prepared on ice to avoid nonspecific amplification and primer–dimer formation. For rapid PCR conducted on the capillary-based LightCycler 1.5 instrument (Roche), Luna Probe One-Step RT-qPCR 4× Mix with UDG (New England Biolabs) was used. Reactions were performed in 10-μL volumes containing 1× Master Mix, 5 μmol/L of each forward and reverse primer, and 250 nmol/L of probe.
6
Quantitative RT-PCR Profiling of Pyrus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a modified CTAB method (Qian et al., 2014a (link)). The total RNA sample was treated with DNase I to remove any contaminating genomic DNA, and then quantified. First-strand cDNA was synthesized from 4 μg DNA-free RNA using a Revert Aid™ First-Strand cDNA Synthesis Kit (Fermentas, Glen Burnie, MD, USA). A 2-μL sample of 10-fold diluted cDNA was used as the template for gene cloning and quantitative real-time polymerase chain reaction (qPCR) analyses.
The qPCR mixture contained 10.0 μL SYBR Premix Ex Taq™ (Takara, Ohtsu, Japan), 0.4 μL each primer (10 μM), 2 μL cDNA, and 7.2 μL RNase-free water in a total volume of 20 μL. The PCR was completed using a LightCycler 1.5 instrument (Roche, Germany) with the following program: 95°C for 30 s; 40 cycles of 95°C for 5 s and 60°C for 20 s. A template-free control was included for each primer pair. The qPCR primers (Supplementary TablesS2 , S3 in Supplementary File 1) were designed using Primer 3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ). All qPCR data were normalized using the threshold cycle value for the Pyrus species actin gene (PyActin, JN684184). Each sample was analyzed three times.
The qPCR mixture contained 10.0 μL SYBR Premix Ex Taq™ (Takara, Ohtsu, Japan), 0.4 μL each primer (10 μM), 2 μL cDNA, and 7.2 μL RNase-free water in a total volume of 20 μL. The PCR was completed using a LightCycler 1.5 instrument (Roche, Germany) with the following program: 95°C for 30 s; 40 cycles of 95°C for 5 s and 60°C for 20 s. A template-free control was included for each primer pair. The qPCR primers (Supplementary Tables
7
Characterizing Pancreatic Cell Transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from digested pancreatic cells w/o FAC sorting using RNeasy (Qiagen, Valencia, CA, USA) and quantified with Nanodrop1000 (Thermo Fisher Scientific, Inc, Waltham, MA, USA) according to the manufacturer’s instructions, followed by cDNA synthesis (Qiagen). Primers were purchased from Qiagen for cyclophilinA (CypA; QT00247709), amylase (QT00179242), CK19 (QT00156667), CD31 (QT01052044), vimentin (QT00159670) and CD45 (QT00139405). RT-qPCR reactions were performed in duplicates with QuantiTect SYBR Green PCR Kit (Qiagen) using a LightCycler 1.5 Instrument (Roche, Branchburg, NJ, USA). Specificity of the amplified products was determined by melting point analysis. Quantification for each gene of interest was performed with the 2−ΔΔCt method. Values for genes were first normalized against CypA, the housekeeping gene control, and then compared to the complete pancreatic digests, without sorting, as an experimental control.
8
Semiquantitative and Quantitative PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with the RNeasy Mini Kit (Qiagen). For cDNA synthesis, 1 μg total RNA and AMV First-Strand cDNA Synthesis Kit (Invitrogen) were used. Semiquantitative PCR was performed with Taq DNA Polymerase (Invitrogen) in MGResearch instrument (Bio-Rad). For primer sequences and PCR conditions (Table 1 ). For densitometric analysis, PCR bands were imaged on the Vilber Lourmat gel imager (Eberhardzell) and analyzed with the BioCapt software provided by the imager. Values were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and presented as fold change. Quantitative PCR was performed in a LightCycler 1.5 instrument equipped with the LightCycler 3.5 software (Roche). Primer kits for Scx and hypoxanthine-guanine phosphoribosyltransferase (HPRT) from Search-LC, and p16, p21, p53, and GAPDH from Qiagen were used in combination with the LightCycler Fast Start DNA Master SYBR Green Kit (Roche). Crossing points for each sample were determined by the second derivative maximum method and relative quantification was performed using the comparative ΔΔCt method. The relative gene expression was calculated as a ratio to HPRT or GAPDH. All PCR results have been reproduced minimum two independent times.
9
Transcriptomic Analysis of Floral Induction in Litchi
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The transcriptomic data was confirmed using RT-qPCR analysis of 13 selected DEGs during floral induction in litchi. Gene-specific primers were designed using the Primer 5.0 program (Additional file 3 ). cDNA was synthesized from total RNA (2 μg) using SuperScript® IV Reverse Transcriptase Kit (Thermo Fisher Scientific, USA) following the manufacturer’s instructions. Unit reaction conditions: 50 mM Tris-HCl (pH 8.3), 4 mM MgCl2, 10 mM DTT, 50 mM KCl, 0.5 mM dTTP, 0.4 MBq/mL [3H]-dTTP, 0.4 mM poly(A) oligo (dT)15 and enzyme in 20 μl for 10 min at 37 °C. The RT-qPCR reactions were performed on a LightCycler 1.5 instrument (Roche, USA) using the following program: hot start at 95 °C for 7 min, followed by 40 cycles of 10 s at 95 °C, 55 °C for 15 s, and 25 s at 72 °C. The unigene expression levels were calculated by using the 2-ΔΔCT method [51 (link)] and normalized to the actin gene [HQ615689] [52 (link)]. Values for each time point was the average of three technical replicates of each biological replicate. Statistical and correlation analysis was performed with SPSS 16.0.
10
Quantitative mRNA Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA quantification was measured by qRT-PCR using the LightCycler 1.5 Instrument and the FastStart RNA Master SYBR Green I kit (both Roche Applied Science). PCR reactions were carried out in a 20 μL mixture composed of 3.25 mmol/L Mn(CH3COO)2, 0.5 μmol/L of each primer, 1 μL sample and 1-fold LightCycler RNA Master SYBR Green I. Primers were synthesized by Integrated DNA Technologies: MCOLN1 sense 5’- AGGGGCTCTGGGCTACC-3’, antisense 5’- GCCCGCCGCTGTCACTG-3’; ATG9B sense 5’-TGTGCTCACCGTCTACGAC-3’, antisense 5’-GGGAGGTAGTGCATGTGGG-3’; UVRAG sense 5’-ATGCCAGACCGTCTTGATACA-3’, antisense 5’-TGACCCAAGTATTTCAGCCCA-3’; polymerase (RNA) II (DNA directed) polypeptide A (POLR2A) sense 5’-GCACCACGTCCAATGACAT-3’, antisense 5’-GTGCGGCTGCTTCCATAA-3’. Reaction parameters were as follows: 61°C at 20 min followed by 95°C at 30 s followed by 45 cycles of 10 s, 95°C; 10 s, 60°C; 15 s, 72°C. Data were analyzed using the Pfaffl method [62 (link)]. The ratio between the target gene mRNA and POLR2A (the reference gene) was then calculated and normalized so that mRNA expression in mock infected cells equals 1.00. Data were then log2 transformed.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!