Abi 7900ht fast real time pcr instrument

Fresh frozen prostate tissue sections from four different patients with Gleason score 7 (3+4) tumors were used for microdissection of stroma from non-malignant tissue, stroma within Gleason grade 3 and stroma within Gleason grade 4. Prior to microdissection, tissue sections were stained for 2 minutes with 50% hematoxylin followed by dehydration for 30 s in 70%, 95% and 100% ethanol respectively. Microdissection was performed using the PALM Laser-MicroBeam System. RNA was isolated with the PicoPure RNA Isolation Kit (Arcturus Engineering Inc.) in accordance with the manufacturer’s instructions. The total RNA isolated from these patients was converted to cDNA using SuperScript III reverse transcriptase (Life Technologies, Carlsbad, CA, USA) and Cav-1 expression was analysed with qRT-PCR with an ABI 7900 HT fast Real-Time PCR instrument (Applied Biosystems, Foster City, CA, USA) using power SYBR green (Life Technologies). The PCR reactions for Cav-1 were carried out with primers (forward: 50-CAAATGCCGTCAAAACTGTG-30, reverse: 50-CGACCCTAAACACCTCAACG-30). The PCR reactions for the internal control RPL13A were carried out with primers (forward: 50-GTACGCTGTGAAGGCATCAA-30, reverse: 50-GTTGGTGTTCATCCGCTTG-30).

Total RNA was isolated from the leukemic cells using the QIAGEN RNeasy Mini Kit and used for cDNA synthesis by TransScript First‐Strand cDNA Synthesis SuperMix. RNA quality was analyzed by NanoDrop. METTL3 (NM_019852.5) and METTL14 (NM_201638.2) transcripts were quantified by SYBRw Green PCR kit using the ABI 7900HT Fast Real‐Time PCR Instrument (Applied Biosystems). The sequences of the amplification primers for METTL3 and METTL14 are listed in Table 2. The amplification efficiency between the target (i.e., METTL3) and the reference control (i.e., GAPDH) was compared to use the delta delta Ct (ΔΔCt) calculation.

RNA isolation, cDNA synthesis, and quantitative PCR were performed as described in detail previously for cells in culture [29 (link)]. Briefly, gene expression was assessed by using the RT² Profiler PCR Array Human Angiogenesis (PAHS-024A) from SABiosciences (Frederick, MD). Real-time PCR was performed on an ABI 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Carlsbad, CA). Each tumor line was run in three biological replicates. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) were used as normalization genes because these housekeeping genes showed stable expression across the melanoma lines studied here. Thus, each replicate C_T-value was normalized to the mean C_T-value of GAPDH and ACTB (ΔC_T = C_T^{gene of interest} – C_T^{mean of GADPH and ACTB}).

Total RNA was isolated from sonicated tissues using a Direct-zol total RNA isolation kit (Zymo Research, Irvine, CA, USA) according to manufacturer’s instructions with in-column DNase I treatment. RNA was reverse transcribed in first strand buffer containing 0.01 M dithiothreitol (DTT), 200 ng random hexamers, 0.5 mM dNTPs and 40U M-MLV according to M-MLV RT protocols (Invitrogen-Life Technologies, Grand Island, NY, USA). To conduct real time quantitative polymerase chain reaction (RT-qPCR), cDNA was added to a reaction mix (10 μL final volume) containing 300 nM gene-specific primers and Universal SYBR green supermix (Bio-Rad, Hercules, CA, USA). All samples were run in triplicate and were analyzed on an ABI 7900 HT Fast Real Time PCR instrument (Applied Biosystems-Life Technologies, Carlsbad, CA, USA) for quantitative monitoring of PCR product formation. Relative gene expression was normalized to Gapdh controls and assessed using the 2^-ΔΔCT method. Primer sequences are as follows: Gapdh: F: CTGCACCACCAACTGCTTAG; Gapdh: R: ACAGTCTTCTGGGTGGCA GT: Iba1: F: GGATTTGCAGGGAGGAAAAG; Iba1: R: TGGGATCATCGAGGAATTG.

Total RNA was isolated from brain tissue using the Aurum Total RNA mini isolation kit (Biorad) according to manufacturer's instructions with in-column DNase I treatment. Random-primed reverse transcription was performed according to manufacturer protocols (Invitrogen—Life Technologies, Grand Island, NY). cDNA was added to a reaction mix (10 µl final volume) containing 300 nm gene-specific primers and Universal SYBR green supermix (Biorad, Hercules, CA). All samples were run in triplicate and were analyzed on an ABI 7900 HT Fast Real Time PCR instrument (Applied Biosystems—Life Technologies). Relative gene expression was normalized to GAPDH controls and assessed using the 2^−ΔΔCT method. Primer sequences are as follows (5′–3′): Gapdh F: CTGCACCACCAACTGCTTAG, Gapdh R: ACAGTCTTCTGGGTGGCA GT, Aif1 (Iba1) F: GGATTTGCAGGGAGGAAAAG Aif1 (Iba1) R: TGGGATCATCGAGGAATTG, Gfap F: GGAGAGGGACAACTTTGCAC, Gfap R: AGCCTCAGGTTGGTTTCATC, Il1b F: CCTGCAGCTGGAGAGTGTGGAT, Il1b R: TGTGCTCTGCTTGTGAGGTGCT, Il6 F: CAAAGCCAGAGTCCTTCAGAG, Il6 R: AGGAGAGCATTGGAAATTGG, Tnfa F: AGCCCACGTCGTAGCAAACCAC, Tnfa R: AGGTACAACCCATCGGCTGGCA, Tgfb F: TGGAGCAACATGTGGAACTC, Tgfb R: GACAGCCACTCAGGCGTATC, Bdnf F: CAATGCCGAACTACCCAATC, Bdnf R: TGGTCAGTGTACATACACAGGAAG.

RNA isolation, cDNA synthesis, and quantitative PCR were performed as described in detail previously [38 ]. Briefly, gene expression was assessed by using the RT² Profiler PCR Array Human Angiogenesis (PAHS-024A) from SABiosciences (Frederick, MD). Real-time PCR was performed on an ABI 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Carlsbad, CA). Each tumor line was run in three biological replicates. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) were used as normalization genes because these housekeeping genes showed stable expression across the melanoma lines studied here. Thus, each replicate C_T-value was normalized to the mean C_T-value of GAPDH and ACTB (ΔC_T = C_T^{gene of interest} – C_T^{mean of GADPH and ACTB}).

RNA isolation, cDNA synthesis, and quantitative PCR were performed as described in detail previously [14 (link)]. Briefly, gene expression was assessed by using the RT² Profiler PCR Array Human Angiogenesis (PAHS-024A) from SABiosciences (Frederick, MD). Real-time PCR was performed on an ABI 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Carlsbad, CA). Each tumor line was run in three biological replicates. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) were used as normalization genes because these housekeeping genes showed stable expression across the melanoma lines studied here. Thus, each replicate C_T value was normalized to the mean C_T value of GAPDH and ACTB (ΔC_T  =  C_T^{gene of interest} − C_T^{mean of GADPH and ACTB}). The normalized expression level of each gene was calculated from the three biological replicates as 2^−meanΔCT.