Mag max express

Viral RNA was extracted from infected allantoic fluids using the MagMax Express semi-automatic magnetic particle extractor (Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. Allantoic fluid samples and reagents were dispensed into X-well microplates prior to magnetic particle processing. After processing, each sample of extracted RNA recovered from the wells of the plates was subjected toRT-PCR amplification.

AMac were stimulated with purified OMV (1 μg), whole cell sonicate (1 μg), live H. parasuis (MOI 2:1) or E. coli 0111:B4 LPS (10 μg/ml) (Invitrogen). After 18 h incubation, media was collected and cells were lysed on the culture plate with TRI reagent (Ambion). RNA was isolated using a MagMax Express (Life Technologies) and cDNA was synthesized using a SuperScript VILO cDNA kit (Invitrogen). SYBR Green-based real-time PCR was conducted for various mRNA targets using SYBR Green Master mix (Life Technologies) following manufacturers’ protocol. All samples were run in duplicate. Levels of mRNA were calculated using the threshold cycle 2^-ΔΔCt method, which expresses mRNA in treated cells relative to non-stimulated cells after normalizing to β-actin [54 (link)]. Primers used were previously reported [55 (link)] and PCR products were < 100 bp in size.

RNA was extracted from monolayers, spheroids, and organoids using a MagMAX-96 Total RNA Isolation Kit (Life Technologies) and MAG Max Express (Applied Biosystems, Grand Island, NY). RNA quantity and quality were determined spectrophotometrically, using a Nano Drop 2000 (Thermoscientific). Reverse transcription was conducted using the SuperScript VILO kit (Invitrogen, Grand Island, NY), according to manufacturer's protocol. Finally, qRT-PCR was carried out using Quantitect Sybr Green MasterMix (Qiagen) on a Step One Plus Real-Time PCR system (Life Technologies). For a list of primer sequences see Supplementary file 3.

Mouse lung tissues were weighed and homogenized. Virus RNA was isolated from 50 μL supernatants of homogenized tissues using a MagMAX™ Express Magnetic Particle Processor nucleic acid extraction instrument (Applied Biosystems). SARS-CoV-2-specific RT-PCR assays were performed using a FastKing One Step Probe RT-qPCR kit (Tiangen Biotech) on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) according to the manufacturer’s protocol. Two sets of primers and probes were used to detect a region of the N gene of viral genome and a region of E gene of sgRNA of SARS-CoV-2, respectively^{41 (link)}. The primer and probe sequences were as follows: N-F, GACCCCAAAATCAGCGAAAT; N-R, TCTGGTTACTGCCAGTTGAATCTG; N-probe, FAM-ACCCCGCATTACGTTTGGTGGACC-TAMRA (where FAM is 6-carboxyfluorescein, and TAMRA is 6-carboxytetramethylrhodamine). sgRNA-E-F, CGATCTCTTGTAGATCTGTTCTC; sgRNA-E-R, ATATTGCAGCAGTACGCACACA; sgRNA-E-probe, FAM-ACACTAGCCATCCTTACTGCGCTTCG-TAMRA. Viral loads were expressed on a log10 scale as viral copies per gram, after calculated with a standard curve. Viral copy numbers below the LLOD were set to half of the LLOD^{46 (link)}.