Lr clonase 2 plus enzyme

The Center for Cancer Systems Biology (Dana Farber Cancer Institute)-Broad Human Kinase ORF collection plasmid kit (Johannessen et al., 2010 (link); Yang et al., 2011 (link))[2, 5] was a gift from William Hahn and David Root (Addgene kit # 1000000014). Each kinase ORF in pDONR-223 vector was cloned into pEZYmyc-His or pEZYflag Gateway destination vectors via LR Clonase II Plus enzyme (Thermo Fisher Scientific) reaction for 4 hr at room temperature followed by transformation into DH5α competent cells and selection from ampicillin-containing LB agar plate. Each kinase ORF expressing clone was confirmed by sequencing analysis.
For screening responsible kinases for NDEL1 S336/S332 phosphorylation, FLAG-NDEL1 plasmid and the expressing clone plasmid were transfected into HEK293 cells and incubated for 48 hr. pEGFP-C3 plasmid and MYC-hTARA construct were transfected with FLAG-NDEL1 to be used as a negative control and a positive control, respectively. Cells were lysed into 1X ELB lysis buffer (50 mM Tris pH 8.0, 250 mM NaCl, 5 mM EDTA, 0.1% NP-40) supplemented with 2 mM NaPPi, 10 mM NaF, 2 mM Na₃VO₄, 1 mM DTT, and protease inhibitor cocktail (Roche, Mannheim, Germany). The lysates were subjected to immunoblotting with FLAG antibody. The candidate kinases were selected by the increment of NDEL1 phosphorylation evidenced by the band shift.

To produce each construct, the coding sequence of each gene was amplified from whole larva cDNA using the PrimeScript RT-PCR Kit (cat #RR014-A; Takara). The amplified sequence was then purified through gel extraction (cat #D2111-03; Magen HiPure Gel Pure DNA Mini kit). Flanking att sequences were added through another round of PCR (cat #R011; Takara) and purified. The resulting products were then recombined into pDONR221 (cat #12536017; Thermo Fisher Scientific) through a Gateway BP reaction with Gateway BP Clonase II Enzyme Mix (cat #11789020; Thermo Fisher Scientific) to produce pDONR221-p24 entry clones. From there, p24 sequences were transferred into modified Gateway destination vector pTSGW (UASt-Signal peptide of Tango1-GFP-Gateway cassette) (Yang et al., 2021 (link)) through Gateway LR recombination using LR Clonase II Plus enzyme (cat #12538120; Thermo Fisher Scientific) to obtain the desired plasmids.
Primers used were as follows: Eclair-F, Eclair-R, att-Eclair-F, and att-Eclair-R; CHOp24-F, CHOp24-R, att-CHOp24-F, and att-CHOp24-R; Logjam-F, Logjam-R, att-Logjam-F, and att-Logjam-R; and Baiser-F, Baiser-R, att-Baiser-F, and att-Baiser-R. Primer sequences are listed in Table S2.

Pathway reporters for CRE, EGR1p, and NFAT elements were cloned using a Multisite Gateway recombination (Thermo Fisher Scientific) strategy as described in⁹⁹ (link) and linked to a firefly luciferase gene and unique barcodes for multiparametric assays. Entry vectors harboring CRE and NFAT sensors were combined with an Entry vector harboring an adenovirus major late promoter (MLP) (pENTR/221_attL4r_MLP_attL3r) and an Entry vector carrying a unique 49-mer barcode (pENTR/221_attL3_Barcode_attL2). The EGR1p Entry vector (pENTR/221_attL4r_EGR1p_attL3r) was combined with the dummy Entry vector (pENTR/221_attL1_dummy_attL4) and a unique 49-mer barcode Entry vector (pENTR/221_attL3_BarcodeLibrary_attL2). Each of the sets containing three Entry vectors were recombined using LR Clonase II Plus enzyme (Thermo Fisher Scientific) into pGL4.16_attR1_Insert_attR2_luc2/Hygro_DEST to yield expression vectors, which are listed in Table S1. The sequences of the expression plasmids were verified using Sanger sequencing.

S. Typhimurium sspH2 was PCR amplified from genomic SL1344 DNA using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGCCCTTTCATATTGGAAGC and GGGGACCACTTTGTACAAGAAAGCTGGGTTCAGTTACGACGCCACTGAACG. The sspH2 amplicon was purified by means of a Nucleospin® Gel and PCR clean-up kit (Macherey-Nagel) according to the manufacturers' instruction and cloned into the Gateway® pDONR221 and pMET7-GAG-SP1 (22 (link)) using BP Clonase II Enzyme (Invitrogen) and LR Clonase II Plus Enzyme (Invitrogen), respectively. The pMD2.G (VSV-G envelope-expressing plasmid; Addgene, plasmid no. 12259) and pcDNA3-FLAG-VSV-G (Addgene, plasmid no. 80606) plasmids were retrieved from Addgene and the pSVsport vector was obtained from Life Technologies. The correctness of the sspH2 insert was confirmed by Sanger sequencing (Eurofins).

GFP was fused to the Dmist_Dr ORF by Gateway cloning (Kwan et al., 2007 (link)). Gene-specific primers were designed to amplify a PCR product that was recombined with middle donor vector (Table 2; Invitrogen Gateway pDONR221 Cat# 12536017, Invitrogen Gateway BP Clonase II Cat# 11789020) to generate a middle entry clone (pME-Dmist). pME-Dmist was recombined with 5′ (p5E-CMV/SP6) and 3′ (p3E-GFPpA) entry clones and destination vector (pDestTol2pA2) using Gateway Technology (Invitrogen LR Clonase II Plus enzyme Cat# 12538200) following the manufacturer’s protocol.
A 3 bp mutation was introduced into the CMV:dreammist-GFPpA by inverse PCR using specific primers (Table 2) and KOD high-fidelity hot start polymerase (Millipore 71085). The template was degraded by DpnI digest and circular PCR product was transformed into OneShot TOP10 chemically competent Escherichia coli (Invitrogen C4040). Both CMV:dreammist-GFPpA and CMV:dreammistA22W-GFPpA constructs were checked by Sanger sequencing.
For labelling the plasma membrane, mRNA was in vitro transcribed from pCS2-myr-Cherry linearised with NotI, in vitro transcribed with SP6 mMessage mMachine (Ambion AM1340), purified and quantified with a QuBit spectrophotometer, and injected at 0.04 μg/μl.