E7637

In order to confirm the cell death, the cells morphology changes were analyzed by the Acridine Orange/Ethidium Bromide double staining method. A number of 10⁴ SW480 cells were seeded into each well of chamber slide (30118, SPL, Korea) and incubated for 24 h in a humidified, 5% CO₂ at 37 °C. The cells were treated with various concentration of metabolites, stained with 10 μl Acridine Orange 50 mg ml^-1 (A6014, Sigma, Germany) and Ethidium Bromide 50 mg ml^-1 (E7637, Sigma, Germany) for 5 min and were washed with PBS. Ultimately, the cell death was characterized under a fluorescence microscope with 400× magnification.

One microliter of template DNA was added into a total of 25 μl reaction solution for PCR containing two primers of 16S rRNA; 1 μl forward primer (27F): AGAGTTTGATCCTGGCTCAG, 1 μl reverse primer (1492R): GGTTACCTTGTTACGACTT, 10 μl PCR-grade water, and 12 μl GoTaq Green Master Mix (Promega, USA) (Table 1). Similarly, gyrB gene was also amplified by species-specific primers. PCR products were electrophoresed in 1% agarose gel stained with ethidium bromide (Sigma-Aldrich E7637, USA) and utilizing a standard-sized molecular marker (1Kb DNA Ladder RTU, GeneDireX). PCR products revealing the thickest bands were sequenced by Sanger’s method at BGI Hong Kong Co. Ltd. China. The obtained sequences were analyzed and compared for taxonomic identification using National Centre for Biotechnology Information-Basic Local Alignment Search Tool (NCBI-BLAST), and subsequently, submitted to the GenBank^® database. To determine the phylogenetic relationship of A. hydrophila, a phylogenetic tree analysis was conducted on the 16S rRNA and gyrB genes of A. hydrophila. This analysis employed the bootstrap method with 1,000 bootstrap replications, and it was carried out using MEGA 11.0 (Molecular Evolutionary Genetic Analysis), as described by Chen, [64 (link)].

FaDu cells were treated with drugs (100 μM) or vehicle control for 24 h under normoxia and hypoxia (<0.1% O₂); cells exposed to 5 Gy ionizing radiation were used as positive controls. Immediately after irradiation, cells were harvested in PBS by scraping, mixed with low melting point agarose, and spread on comet slides. After the gel solidified, slides were put in lysis solution (4250-050-01, R&D Systems, Minneapolis, MN) for 1 h, and then in unwinding solution (200 mM NaOH, 2.5 mM EDTA) for 1 h at 4 °C. Slides were then placed in alkaline electrophoresis buffer (200 mM NaOH, 1 mM EDTA), and current was applied at 21 V for 45 min. Afterwards, slides were washed twice in distilled H₂O, fixed with 70% ethanol for 5 min, and air dried before staining DNA with ethidium bromide (E7637, Sigma-Aldrich). Slides were imaged with an upright fluorescence microscope (Zeiss AxioImager.Z1), and comets were analyzed using CometScore™ software (TriTek Corp., Sumerduck, VA).

Virulence genes of A. hydrophila (including hemolysin (hylA), aerolysin (aerA), and cytotoxic enterotoxin (act)) and antimicrobial resistance genes (such as sul1, sul3, qnrA, qnrB, blaTEM, and tetA) of A. hydrophila were identified through PCR analysis using species-specific primers (Macrogen, Korea) and were compared with a standard-sized molecular marker DNA ladder (Table 1). A total of 25 μl of PCR reaction solution, comprising 1 μl of template DNA, 1 μl forward primer, 1 μl reverse primer, 10 μl PCR-grade water, and 12 μl GoTaq Green Master Mix (Promega, USA), was utilized for the detection of the AMR genes in A. hydrophila (Table 1). Amplified PCR products were analyzed on 1% agarose gel stained with ethidium bromide (Sigma-Aldrich E7637, USA) and utilizing a standard-sized molecular marker (1Kb DNA Ladder RTU, GeneDireX). PCR products revealing the thickest bands were sequenced by Sanger’s method at BGI Hong Kong Co. Ltd., China as previously analyzed by Wang, [73 (link)].

Total RNA was extracted with the RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s protocol. The RNA was quantified spectrophotometrically at 260 nm, and cDNA was synthesized from the total RNA at 42 °C for 1 h and at 95 °C for 5 min with a first-strand cDNA synthesis kit (K-2041; Bioneer Corporation, Daejeon, Korea) and oligo d(T) primers. The RT-PCR Premix Kit (K-2016; Bioneer Corporation) was used to amplify SOX2, OCT4, NANOG, and GAPDH with primers synthesized by the Bioneer Corporation. The PCR conditions were as follows: 95 °C for 5 min, followed by 32 cycles at 95 °C for 60 s, 58 °C for 60 s, 72 °C for 60 s, and then, 72 °C for 10 min. The primers used for the amplification are listed in Table S1. The PCR products were resolved by electrophoresis on 1.5% agarose gel and visualized with ethidium bromide (E7637; Sigma-Aldrich; Merck KGaA) staining.

AO/EB dual staining assay was performed to detect apoptotic body formation in the apoptotic cells. This staining assay can discriminate among live cells, early apoptotic cells, and late apoptotic cells. After successful transfection with piR-39980 and treated with DOX as mentioned above, HT1080/DOX cells were washed with 1X PBS and incubated with 5 μg/mL (In 1X PBS) acridine orange (Himedia; MB116) and ethidium bromide (Sigma; E7637) at room temperature for 20 mins in the dark. Then the excessive stains were washed twice with 1X PBS, and the nuclei were observed under a confocal microscope (Leica TCS SP8). The AO was excited with 502 nm wavelength light which emitted 525 nm wavelength green lights. The EB was excited with 526 nm wavelength light which emitted 605 nm wavelength orange-red light.

For performing this experiment, the A375 cells (1 × 10⁶ cells) were separately seeded in the petri dish, and by passing 24 h from the incubation time in 5% CO₂ at 37 °C, one petri was considered as the control (dark) and the other one was treated with rutoside (4 h), and then MB-PDT was performed as it described earlier. After 24 h, the cells were pelleted, resuspended in 100 µL of PBS, and were then stained with Acridine Orange/Ethidium Bromide (AO/EB) in terms of the published procedures [43 (link)]. The concentrations of AO (Sigma, USA- A6014) and EB (Sigma, USA-E7637) were considered to be 0.1 and 0.25 mM, respectively. The control and treated A375 cells were stained with Hoechst 33258 (1 mg/mL) and other steps were done as mentioned for AO/EB staining. Morphological alternation because of induction of apoptosis, were detected using fluorescence microscopy (BEL, Italy).
In order to determine the percentage of apoptotic cells in rutoside and then MB-PDT treated cells, and compare it with the control cell, the cancer cells were stained with Annexin-V and propidium iodide (PI) and were then incubated for 10 min at 25 °C in darkness. At the end, the cells were analyzed using flow cytometry. FlowJo 7.6.1 software was also used for data analyses.