Dimethylsufoxide dmso

Manufactured by Merck Group

Sourced in United States

Dimethylsulfoxide (DMSO) is a colorless, odorless, and water-soluble organic compound. It is widely used as a solvent in various laboratory applications due to its unique properties. DMSO has a high boiling point, low toxicity, and the ability to dissolve a wide range of polar and non-polar compounds. Its core function is to serve as a versatile solvent for various chemical and biological research purposes.

Automatically generated - may contain errors

Lab products found in correlation

6 protocols using dimethylsufoxide dmso

Antibacterial Activity Screening of Natural Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols

From recent overnight cultures, microbial suspensions with turbidity equivalent to 0.5 tube of the McFarland scale (1.5 × 10⁸ CFU/mL) were prepared. Each bacterial strain was seeded on Mueller-Hilton agar (MHA) plates (DIFCO-Becton Dickinson Microbiology Systems, Bergen, NJ, USA). Next, wells (6 mm diameter) prepared in MHA plates were filled with 50 μL of 200,000 µg/mL extract/fractions solutions (resulting in 10,000 µg of each sample in each well). Dimethylsufoxide (DMSO; 50 μL of a 1% solution; Sigma-Aldrich^®, St. Louis, MO, USA) and ciprofloxacin (50 μg per well; Laborclin, Paraná, Brazil) were used as negative and positive controls, respectively. The plates were incubated at 35 °C. After 24 h, the formation of inhibition diameter zone (IDZ) around the wells was recorded (CLSI, 2015). The experiments were performed in triplicate.

Figueiredo C.S., Branco Santos J.C., Castro Junior J.A., Wakui V.G., Rodrigues J.F., Arruda M.O., Monteiro A.D., Monteiro-Neto V., Bomfim M.R., Kato L., Nascimento da Silva L.C, & Grisotto M.A. (2017). Himatanthus drasticus Leaves: Chemical Characterization and Evaluation of Their Antimicrobial, Antibiofilm, Antiproliferative Activities. Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry, 22(6), 910.

+ Open protocol

+ Expand

Cell Proliferation on Copper Scaffolds

Check if the same lab product or an alternative is used in the 5 most similar protocols

To assess cell proliferation upon exposure to the copper loaded scaffolds, an MTT (3-(4, 5dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide, Sigma-Aldrich, Saint Louis, MO, USA) assay was performed. The scaffolds of 6 × 6 × 1 mm (length × width × height) cylindrical scaffolds were sterilized with ethanol for 15 min and then dried under ultraviolet light for 20 min and placed into a sterile 96 well plate. The hMSCs of 2 × 10⁴ cells per scaffold were seeded and cultured in the CO₂ incubator at 37 °C for 1, 3, or 7 days. In the post-incubation period, the growth medium was removed and replaced with 10% MTT solution mixed with serum media. The plates were then incubated at 37 °C for 2 h. After this period, media was removed and 200 µL of DMSO was added to the plate. After 5 min of incubation at 37 °C, the dimethylsufoxide (DMSO, Sigma-Aldrich, Saint Louis, MO, USA) was added and read at 570 and 700 nm in a multi-well plate reader (BioTek, Winooski, VT, USA).

Pillai A., Chakka J., Heshmathi N., Zhang Y., Alkadi F, & Maniruzzaman M. (2023). Multifunctional Three-Dimensional Printed Copper Loaded Calcium Phosphate Scaffolds for Bone Regeneration. Pharmaceuticals, 16(3), 352.

+ Open protocol

+ Expand

Investigating Inflammatory Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

LPS, MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide], phenylmethylsulfonyl fluoride (PMSF) and the components of the whole cell lysis buffer for Western blot analysis and dimethylsufoxide (DMSO) were purchased from the Sigma Chemical Co. (St. Louis, MO). Dulbecco's modified Eagle's medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco BRL (Grand Island, NY). The Griess reagent kit was purchased from Beyotime Chemical Co. (Jiang Su, China). Antibodies against COX-2, iNOS, β-actin, NF-κB p65, IκBα, Lamin B, phospho-ERK1/2, ERK1/2, phospho-p38, p38, phospho-JNK/SAPK and JNK/SAPK were purchased from Cell Signaling Technology (Danvers, MA). RAW 264.7 mouse macrophage cells were purchased from Shanghai Institutes for Biological Sciences (Chinese Academy of Sciences, China). Methanol (HPLC grade) was purchased from Fisher Scientific (Fair Lawn, NJ). All other chemicals were commercial products of reagent grade.

Xu J., Zhao Y, & Aisa H.A. (2017). Anti-inflammatory effect of pomegranate flower in lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages. Pharmaceutical Biology, 55(1), 2095-2101.

+ Open protocol

+ Expand

Neuroprotective Effects of SCH58261 in Rat OGD Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 24 immature Wistar rats, aged 6.5 days and weighing 34.2 ± 2.6 g, were used in this study. They were housed in a ventilated facility with an ambient temperature (26 ± 2 °C) and 12-hour light/dark cycles. All rats had free access to a standard diet and water.
Prior to the experiments, animals were randomly divided into equal groups of four. The sham (SHAM) group received no treatment, the vehicle (VEHICLE) group received 0.1% dimethylsufoxide (DMSO) (Sigma, Germany), the injury (INJ) group was exposed to 20 min of oxygen-glucose deprivation (OGD) and the injury + SCH58261 (INJ + SCH58261) group was exposed to 20 min of OGD and received 1 μM SCH58261 (7-(2-phenylethyl)-5-amino-2-(2-furyl)-pyrazole-[4,3-e]-1,2,4-triazolo[1,5-c]pyrimidine, Tocris Bioscience, Germany). All research was performed according to regulations by the Research Ethics Committee at the Biotechnology Research Center of the University of Tripoli, Libya (approval number: BEC-BTRC 8–2019).

Al-Griw M.A., Alghazeer R.O., Awayn N., Shamlan G., Eskandrani A.A., Alnajeebi A.M., Babteen N.A, & Alansari W.S. (2020). Selective adenosine A2A receptor inhibitor SCH58261 reduces oligodendrocyte loss upon brain injury in young rats. Saudi Journal of Biological Sciences, 28(1), 310-316.

+ Open protocol

+ Expand

MPNST Cell Line Characterization and Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human NF1-associated MPNST cell lines NF90.8 and ST88-14 were provided by Dr Michael Tainsky (Wayne University, Detroit, MI), T265-2C was obtained from Dr Steven Porcelli (Albert Einstein College of Medicine, Bronx, NY), and sNF96.2 was purchased from ATCC (Manassas, VA) [15 (link), 16 (link)]. MPNST cells were maintained in RPMI 1640 medium (Sigma) containing 10% of fetal bovine serum (BenchMarck, Gemini Bio-Products, West Sacramento, CA) and 1% penicillin- streptomycin (Invitrogen Life Technologies, Carlsbad, CA) at 37°C in an humidified 5% CO₂ atmosphere. MPNST cells were transiently transfected with 10 nM of siRNA duplex mTOR#13 (CCAAAGUCAAUGUGCAGGAUCUUCCCA) or mTOR#19 (GCCAAGACACAGUAGCGAAUGUCAGGG) (Integrated DNA Technology, Coralville, IA) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Non-targeting GFP siRNA (IDT DNA Technologies) was used as control. Cells were irradiated in a Caesium¹³⁷ (2.24 Gy/min) radiation source Gammacell 1000 (MDS Nordion, Ottawa, ON, Canada). All compound were purchased from LC Laboratories (LC Laboratories, Woburn, MA), with exception of dichloroacetic acid (Tocris, Ellisville, MO) and dissolved in dimethyl sufoxide (DMSO) (Sigma).

Yamashita A., Baia G., Ho J., Velarde E., Wong J., Gallia G., Belzberg A., Kimura E, & Riggins G. (2014). PRECLINICAL EVALUATION OF THE COMBINATION OF mTOR AND PROTEASOME INHIBITORS WITH RADIOTHERAPY IN MALIGNANT PERIPHERAL NERVE SHEATH TUMORS. Journal of neuro-oncology, 118(1), 83-92.

+ Open protocol

+ Expand

Quantifying Cell Viability Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ethanol 95%, denatured was from HmbG (Hamburg, Germany) and Cellulose thimble was purchased from Whatman (Maidstone, United Kingdom). Xanthan gum was purchased from EvaChem (Selangor, Malaysia). Glycerol was from Merck (Massachusetts, United States), Ethylenediaminetetraacetic acid EDTA, 99%pure was purchased from ACROS Organics (Massachusetts, United States). Phosphate Buffered Saline (PBS) pH 7.4 (1×) (without Ca2+ and Mg2+) and Dimethyl sufoxide (DMSO) were from Sigma Aldrich (Missouri, USA). Dulbecco's Modified Eagle Medium (DMEM) and Foetal bovin Serum (FBS) were purchased from Gibco Life Technologies (California, USA). Tetrazolium salt (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Molecular Probes, Life Technologies (California, USA).

Yaseen M.R., Faisal G.G., Fuaat A.A., Affandi K.A., Alallam B., & Nasir M.H.M. (2021). Preparation of Euyrycoma Longifolia Jack (E.L) Tongkat Ali (Ta) Root Extract Hydrogel for Wound Application. Pharmacognosy Journal, 13(6), 1456-1463.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!