Gotaq flexi dna polymerase system

S. aureus bacteriophage types (Sa1int–Sa7int) were detected by multiplex PCR as previously reported with the following modifications (Goerke et al., 2009 (link)). PCRs were performed with the GoTaq Flexi DNA polymerase system (Promega, Mannheim, Germany). Each reaction mix (25 μl) contained 5 μl 5 × GoTaq reaction buffer, 100 μM deoxynucleoside triphosphates (dATP, dCTP, dGTP, and dTTP; Roche Diagnostics, Mannheim, Germany), 5 mM MgCl2, 320 nM of each primer, 1.0 U GoTaq® Flexi DNA polymerase and 10–20 ng of template DNA. An initial denaturation of DNA at 95°C for 5 min was followed by 25 cycles of amplification (95°C for 30 s, 55°C for 30 s and 72°C for 45 s), ending with a final extension phase at 72°C for 10 min. All PCR products were resolved by electrophoresis in 1.5% agarose gels (1 × TBE buffer), stained with RedSafe^TM (INtRON Biotechnology, Korea) and visualized under UV light. Positive controls included DNA from Saint gene-positive S. aureus reference strains Newman (Sa3int, Sa5int, Sa6int, Sa7int), MSSA476 (Sa4int), USA300 (Sa2int, Sa3int), and T132-1 (Sa1int, Sa3int) (Goerke et al., 2009 (link)). In addition to standard PCR controls for contamination events, S. aureus strain 8325-4 served as phage-negative control.

We used the EZ-Tn5 (Lucigen) transposon mutagenesis system for random insertion into the Brucella genome according to the manufacturer's recommended protocol. The insert was cloned into the transposon construction vector pMOD-3 ori/MCS> so that rescue cloning could be performed to determine the insertion site within the transformed Brucella. The partial OVA sequence was amplified from the vector pPL2erm-ActA100-B8R-OVA (kind gift from J. D. Sauer). Primers incorporated a Brucella ribosome binding site (RBS) designed using the algorithm RBS Calculator v2.0 for high-translation initiation (59 (link), 60 (link)). The primers also contained EcoRI and BamHI restriction sites for subcloning into pECFP-N1 (Clontech) to produce an OVA-CFP fusion protein. Primers were as follows: N′-TGAAAGCAAAAGCAGAGAATTCTGGAATATTTTAATTCAGTATCAAAGAGAGGTAAACATGCAAGCCAGAGAGCTCATCA; C′-TTGAGGATCCTTCAGGCTCTCTGCTGAGGAGATGCCAGACAGA. PCR was performed using the GoTaq Flexi DNA polymerase system (Promega) with 6 mM MgCl₂ and 55°C annealing temperature. The 632-bp product was subcloned into pECFP-N1. The fusion product was inserted into the EcoRI/XbaI site of pMOD-3. Finally, the kanamycin resistance sequence was added to the SalI site from pUC4k (Amersham) that we had modified to be flanked by loxP sites. The final product was named pMOD3-OVA-CFP. The map can be seen in Fig. S1 in the supplemental material.