M2200

Library preparation was done similar to Blecher-Gonen et al. (41 (link)) with some changes. Briefly, Sonicated DNA was subjected to a 50 μl end repair reaction using 1 μl End repair mix (E6050L, NEB), cleaned by 1.8× Ampure XP beads, followed by a 50μl A-tail reaction using 2 μl Klenow fragment exo- (M0212L, NEB). The products were cleaned by 1.8× beads and were ligated by 2 μl quick ligase (M2200, NEB) to 0.75 μM illumina compatible forked indexed adapters. Ligation products were size selected by 0.7× PEG (considering the PEG in the ligation buffer) in order to remove free adaptors. 12–19 cycles of amplification were performed by PFU Ultra II Fusion DNA polymerase (600670, Agilent) with the following Primers:

P7 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC 3′,

P5 5′ CAAGCAGAAGACGGCATACGAGAT 3′.

Amplified DNA was size selected for 300–700 bp fragments by taking the supernatant after using 0.5× beads (which removed fragments greater than 700 bp) followed by a 1.0× beads cleaning (which removed remaining primers and adapter dimers). The final quality of the library was assessed by Qubit and TapeStation. Libraries were pooled and sequenced on NextSeq (illumina) for 75 bp paired-end sequencing, generating 10M reads per each library.

10⁶ harvest cells for two biological replicates of control and MAZ KD samples were crosslinked in a resuspension buffer of 10 ml PBS and 100 μl FBS, and 1% formaldehyde for 9 min at RT. The crosslinking was quenched with 250 mM glycine for 5 min at RT and 15 min on ice. The crosslinked cells were lysed with 10nM Tris–HCl pH 8, 10 mM NaCl, and 0.2% IGEPAL CA630, and digested with 100 U MboI. The digested fragments were labelled with biotin-14-dCTP and re-ligated with T4 DNA Ligase. The ligated samples were reverse-crosslinked with 2 μg/μl proteinase K, 1% SDS, and 500 mM NaCl overnight at 65°C. The DNA fragments were extracted with AMPure XP beads (Beckman Coulter, A63881) and sonicated (Covaris, S220) into optimal lengths (around 300∼400 bp). The biotin-labelled DNA fragments were pulled down with Dynabeads MyOne streptavidin T1 beads (Invitrogen, 65602), and thoroughly washed. Hi-C libraries were generated by performing DNA end repair, removal of un-ligated ends, adenosine addition at 3′ end (NEB, M0212), ligation of Illumina indexed adapters (NEB, M2200), and PCR amplification (Thermo Fisher Scientific, F549). The in situ Hi-C libraries were sequenced in 100bp paired-end mode using MGI DNBSEQ-G400 platform.