Anti camki

Antibodies for flow cytometry, anti-Kit-APC, anti-Mac-1-APC, anti-Gr-1-PE, anti-CD3-APC, and anti-B220-PE, were purchased from BioLegend and used as described [1 (link)]. The manufacturers and catalog numbers for other antibodies and reagents are as follows: anti-PirB-PE, R&D Systems, FAB2754P; pCAMKI, Santa Cruz, sc-28438; anti-pCAMKII, Abcam, ab32678; anti-pCAMKIV, Santa Cruz Biotechnology, sc-28443-R; anti-CAMKI, Abcam, ab68234; anti-CAMKII, Cell Signaling, 4436; anti-CAMKIV, Cell Signaling, 4032; anti-pCREB, Cell Signaling, 9198S; anti-CREB, Cell Signaling, 9197S; anti-actin, Sigma Aldrich, A2066; STO-609, Sigma Aldrich, S1318; KN93, Sigma Aldrich, K1385; The PCR primer sequences were as follows: hCAMKI forward: CGGAGGACA TTAGAGACA, reverse: CTCGTCATAGAAGGGAGG-3; hCAMKIV forward: GATGAAAGAGGCGATCAG, reverse: TAGGCCCTCCTCTAGTTC. PirB forward: GAG AATCACCAGACACATGC, PirB reverse: CTGCCCTCATGTCTTAACTT, mCAMKIV forward: AAGCAGGCGGAAGACATTAGG, CAMKIV reverse: AGTTTCTGAGTCCTCTTGTCCT.

The small and large intestines of house musk shrews were both resected 1–2 h after oral administration of the spores and fixed using the Swiss roll method [19 (link)]. Paraffin blocks were sectioned at 5–6 μm thickness and deparaffinized. For immunohistochemical staining, ribbons were rehydrated, with endogenous peroxidases being quenched with 3% H₂O₂ in methanol for 30 min in the dark. After washing with PBS for 20 min, the ribbons were blocked with 1% bovine serum albumin (Sigma–Aldrich, St. Louis, MO, USA) for 20 min. The ribbons were then incubated with primary antibodies at the following dilutions in blocking buffer: Mouse anti-serotonin (1:250, LSBio, Seattle, WA, USA), anti-c-fos (1:100, Abcam, Cambridge, UK), anti-mast cell tryptase (1:200, Abcam), anti-chromogranin A (1:400, Abcam), and anti-CaMKI (1:50, Abcam). After washing in PBS, the ribbons were incubated with the secondary antibody, horseradish peroxidase-conjugated anti-mouse IgG (1:500, Cell Signaling, Danvers, MA, USA). After washing, the color was developed using a substrate, DAB (3,3′-diaminobenzidine tetrahydrochloride), before being counter-stained with hematoxylin.