C fos sc 52x

Electric mobility gel shift assay (EMSAs) were done with the DIG Gel Shift kit (Roche Diagnostics) following the manufacturer's suggested protocol. Probe DNA fragments were digoxigenin (DIG)‐labeled. EMSAs for NF‐kB and AP‐1 were performed with 2 μg of nuclear extract incubated with 1 μg of poly(dI:dC) in 20 mL of 1× binding buffer (10 mM Hepes [pH 7.6], 60 mM KCl, 0.1 mM EDTA, 1 mM DTT, 4% glycerol, and 0.2 μg/mL BSA) with DIG‐labeled probe for 20 min at room temperature. Complexes were resolved on 5% nondenaturing PAGE with 0.5‐fold TBE running buffer. DNA–protein complexes were electroblotted to nylon membrane for 1 h at 280 mA and the bands shift were visualized according to the user's manual for the DIG Gel Shift kit. For the supershift assay, we incubated protein–DNA complexes with 4 μg of antibodies specific for c‐Jun (sc‐45x), Jun B (sc‐46x), Jun D (sc‐74x), and c‐Fos (sc‐52x) (all from Santa Cruz Biotech) for 15 min on ice before electrophoresis. Sequence for the probes NF‐κB: 5’‐TCGAAGTTGAGGGGACTTTCCCAGGC‐3’. AP‐1: 5’‐TCGACGCTTGATGAGTCAGCCGGAA‐3’.