Ambion maxiscript t7 kit

The morpholinos of p53 was purchased from Gene Tools LLC (Philomath, Oregon, USA) and dissolved in ddH₂O at 3 mM (stock solution). The full-length of stmn4 was amplified with the specific primers, F primers: 5’ ATGACCTTGGCAGCATATCGAGACA 3’, R primers: 5’ CTACCGAACTGAAAAGCTACCAGAA 3’, and the stmn4 full-length mRNA was synthesized using the Ambion MAXIscript T7 Kit (Cat#AM1344, Invitrogen, USA) as instructed by the manufacturer. In all experiments, the MOs and mRNAs were injected into one-cell stage embryos, respectively, with the MO dose of p53 at 0.6 mM, and the concentrations of stmn4 mRNA at 200 ng/µL.

The morpholinos of epc1a, epc2 and dlst were purchased from Gene Tools LLC (Philomath, Oregon, USA) and dissolved in ddH₂O at 3 mM concentration (stock solution). The sequences of MOs are listed in Table S5. The dlst MO sequence has been reported previously.²¹ (link) The full-length epc1a, epc2 and dlst were amplified with the specific primers shown in Table S6, and synthesized using the Ambion MAXIscript T7 Kit (Cat# AM1344, Invitrogen, USA) as instructed by the manufacturer. In all experiments, the MOs and mRNAs were injected into one-cell stage embryos, with the MO doses of epc1a, epc2 and dlst at 0.6 mM, 0.9 mM and 0.6 mM, and the mRNA concentrations of epc1a, epc2, dlst, srf and foxr2 at 150 ng/μL, 150 ng/μL, 200 ng/μL, 200 ng/μL and 200 ng/μL, respectively.

Epc1a, epc2, and dlst in zebrafish (Danio rerio) were knocked out using CRISPR/Cas9 technolog.²² (link)^,23 (link) The guide RNAs (gRNAs) were designed using the CRISPR design tool (http://crispr.mit.edu) and synthesized by in vitro transcription using a Thermo Transcript Aid T7 High Yield Transcription Kit (Cat# K0441, Invitrogen, USA) with the primer sequences listed in Table S2. Cas9 mRNAs were obtained by the Ambion MAXIscript T7 Kit (Cat# AM1344, Invitrogen, USA). Mutants were generated by co-injecting the gRNAs (80 ng/μL) and Cas9 mRNA (500 ng/μL) into wild-type embryos at the one-cell stage, and homozygous mutants were screened by amplifying the genomic region flanking the gRNA target sites of each gene using the specific primers listed in Table S3. Finally, the following homozygous mutants were acquired: epc1a^−/− (with an 11 bp deletion in exon 1), epc2^−/− (with a 4 bp deletion in exon 1), and dlst^−/− (with an 18 bp insertion in exon 8). epc1a^−/−epc2^−/− double mutant line was obtained by mating adult epc1a^−/− mutants with epc2^−/− adult mutants and screening the offspring of incrossed epc1a^+/−epc2^+/− heterozygous mutants.