Advantage 2 pcr enzyme system kit

An aliquot of the RNA extracted above from frozen tissue of the index case by Trizol Reagent (Invitrogen) was used to confirm the novel fusion transcript identified by FusionSeq. RNA quality was determined by Eukaryote Total RNA Nano Assay and cDNA quality was tested for PGK housekeeping gene (247 bp amplified product). Three microgram of total RNA was used for cDNA synthesis by SuperScript® III First-Strand Synthesis Kit (Invitrogen). RT-PCR was performed using the Clontech Advantage 2 PCR Enzyme System kit (Clontech, Mountain View, CA) for 33 cycles at a 65°C annealing temperature, using the following primers: LMNA intron 3 forward primer, 5′–CCATCAGACAAGTTAGGTCATAGGG–3′, and FOS exon 4 reverse primer, 5′–GATGCTCTTGACAGGTTCCACTG–3′. Amplified products were purified and sequenced by Sanger method after confirmed by gel electrophoresis.

Genomic DNA was extracted from either frozen or formalin-fixed paraffin-embedded tissue, using the phenol/chloroform method or the QIAamp DNA FFPE Tissue Kit (Qiagen, Valencia, CA), respectively. The targeted exon regions of candidate genes were amplified by the PCR using corresponding forward and reverse primers (Supplementary Table 1). PCR was conducted using the Clontech Advantage 2 PCR Enzyme System kit (Clontech, Mountain View, CA). The PCR products were purified using QIAquick PCR Purification Kit (Qiagen) and confirmed by Sanger sequencing. All mutations were verified bidirectionally.