Verso cdna synthesis kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, Lithuania, United Kingdom, Japan, France, India, Canada, Belgium

The Verso cDNA Synthesis Kit is a reagent system used for the reverse transcription of RNA to complementary DNA (cDNA). The kit provides the necessary components, including reverse transcriptase enzyme, primers, and buffers, to enable the conversion of RNA into cDNA for further analysis or applications.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

CDNA synthesis kit (1264 citations) Verso cDNA kit (292 citations) Verso (14 citations) CDNA kits (3 citations)

968 protocols using verso cdna synthesis kit

Lung Tissue RNA Isolation and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from lung tissue were isolated using TRIzol reagent (Invitrogen, USA) and cDNA synthesis was performed using the Verso cDNA synthesis kit (Thermo Fisher Scientific, USA) as described previously,23 (link),25 (link) RNA was rendered DNA-free and re-purified using the RNeasy mini kit (Qiagen, USA) and RNAs were reverse-transcribed using Verso cDNA synthesis kit (Thermo Fisher Scientific, USA). Quantitative real-time PCR was performed using Biometra TProfessional thermocycler (Analytik Jena, Germany) and SYBR green master mix (Applied Biosystems, USA). Gene expression levels were calculated relative to Ppia (cyclophilin A) using 2^−∆∆Ct as described previously24 (link),28 (link) using the primers sequences derived from MGH primer bank.

Balkrishna A., Solleti S.K., Singh H., Singh R., Sharma N, & Varshney A. (2021). Biotite-Calx Based Traditional Indian Medicine Sahastraputi-Abhrak-Bhasma Prophylactically Mitigates Allergic Airway Inflammation in a Mouse Model of Asthma by Amending Cytokine Responses. Journal of Inflammation Research, 14, 4743-4760.

+ Open protocol

+ Expand

Yeast RNA Extraction and qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was harvested from yeast cells in exponential growth in Yeast Extract-Peptone-Dextrose (YPD) broth using the RiboPure RNA purification kit for yeast (Invitrogen), and then treated with DNaseI. cDNA was synthesized using Verso cDNA synthesis kit (Fisher Scientific). Genomic DNA contamination was checked by PCR with primers flanking the intron of C. glabrata ACT1. Primers used are summarized in Supplemental Table 1^{43 (link),58 ,59 (link)}. Quantitative PCR with SYBR Green qPCR Master Mix (Fisher Scientific) was performed with 1:10 diluted cDNA. Target gene expression was calculated using the ΔΔCT method, with normalization to the housekeeping genes ACT1 and Cg18S. All experiments were done in independent biological triplicates and are shown as mean with standard deviation (SD) for each time point.
For mitochondrial copy number determination, we used quantitative PCR, with COX1 as target for mitochondrial gene and ACT1 for control (Supplemental Table 1). The amplification was performed using Maxima SYBR Green qPCR Master Mix (ThermoFisher Scientific, Waltham, MA, USA).

Badrane H., Cheng S., Dupont C.L., Hao B., Driscoll E., Morder K., Liu G., Newbrough A., Fleres G., Kaul D., Espinoza J.L., Clancy C.J, & Nguyen M.H. (2023). Genotypic diversity and unrecognized antifungal resistance among populations of Candida glabrata from positive blood cultures. Research Square.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from one quarter of a mouse kidney using RNeasy Plus Mini Kit (Qiagen, 74134). For quantitative real-time PCR, an equal amount of RNA was reverse transcribed using Verso cDNA synthesis kit (Fisher Scientific, AB1453B) according to the manufacturer’s protocol. Real-time polymerase chain reaction (PCR) was performed using ABsolute Blue QPCR Mix, SYBR Green (Thermo Scientific, AB4322B). Relative abundance of mRNA was normalized to ribosomal protein U36b4 unless otherwise specified. qRT-PCR primers were designed using Primer-Blast. Primers are listed in Supplemental Table 1.

Rauckhorst A.J., Martinez G.V., Andrade G.M., Wen H., Kim J.Y., Simoni A., Mapuskar K.A., Rastogi P., Steinbach E.J., McCormick M.L., Allen B.G., Pabla N.S., Jackson A.R., Coleman M.C., Spitz D.R., Taylor E.B, & Zepeda-Orozco D. (2023). Tubular Mitochondrial Pyruvate Carrier Disruption Elicits Redox Adaptations that Protect from Acute Kidney Injury. bioRxiv.

+ Open protocol

+ Expand

Quantification of GNMT Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation was conducted using the Qiagen RNeasy kit according to standard manufacture's protocols. cDNA synthesis was conducted using 1 ug of total RNA and the Verso cDNA Synthesis Kit (Fisher Scientific). A 3∶1 mix (v/v) of random hexamers and anchored oligo-dT was used following standard theromocycling conditions. For GNMT quantitative real-time PCR, Taqman MGB probes and primers were used (Hs002219089) (Applied Biosystems). All samples were run in triplicate in 10 µl reaction volumes. PCR conditions were the default settings of the ABI Prism 7900 HT Sequence Detection System (Applied Biosystems) using the standard curve setting to achieve raw data, which was analyzed in Microsoft Excel. The cycle threshold (Ct) was determined during the geometric phase of the PCR amplification plots as automatically set by the 7900 software. Relative differences in transcript levels were quantified using the ΔΔCt method with GAPDH [MIM 138400] (probe 4333764F) mRNA as an endogenous control.

Williams S.R., Yang Q., Chen F., Liu X., Keene K.L., Jacques P., Chen W.M., Weinstein G., Hsu F.C., Beiser A., Wang L., Bookman E., Doheny K.F., Wolf P.A., Zilka M., Selhub J., Nelson S., Gogarten S.M., Worrall B.B., Seshadri S, & Sale M.M. (2014). Genome-Wide Meta-Analysis of Homocysteine and Methionine Metabolism Identifies Five One Carbon Metabolism Loci and a Novel Association of ALDH1L1 with Ischemic Stroke. PLoS Genetics, 10(3), e1004214.

+ Open protocol

+ Expand

Quantitative PCR analysis of gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the myotubes using the NucleoSpin RNA/protein purification kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol. The RNA was reverse transcribed using the Verso cDNA Synthesis Kit (Fisher Scientific, Illkirch, France). Quantitative PCR was performed in triplicate wells with gene-specific primers using the LightCycler 480 system (Roche, Basel, Switzerland) and SYBR Green 1 Master Mix (Roche) as follows: 40 cycles of amplification with 10 s at 95 °C, 20 s at 60 °C and 20 s at 72 °C. The list of the primers used in this manuscript is presented in Table S1. Ct values of the target gene were normalized to the Ct values of the housekeeping gene RPLP0. The expression level of each transcript was determined using the 2^−ΔΔCt method.

Catteau M., Passerieux E., Blervaque L., Gouzi F., Ayoub B., Hayot M, & Pomiès P. (2021). Response to Electrostimulation Is Impaired in Muscle Cells from Patients with Chronic Obstructive Pulmonary Disease. Cells, 10(11), 3002.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation was performed with Trizol according to manufacturer's protocol (Fisher). Total RNA (100–500 ng) was reverse transcribed using the Verso cDNA synthesis kit (Fisher) and cDNA was used for qPCR. qPCR was performed as described (Quintana et al., 2017). Primers for qPCR are as follows: (a) axin2 fwd 5′‐CAACCAAGCACATCCATCAC‐3′ and rev 5′‐TCCATGTTCACCTCCTCTCC‐3′, (b) rpl fwd 5′‐TCCCAGCTGCTCTCAAGATT‐3′ and rev 5′‐TTCTTGGAATAGCGCAGCTT‐3′, (c) sox10 fwd 5′‐ACGCTACAGGTCAGAGTCAC‐ 3′ and rev 5′‐ATGTTGGCCATCACGTCATG‐3′, (d) edn1 fwd 5′‐CAAACACAAGCTGGCAGAAA‐3′ and rev 5′‐CGTGTGCAGTGAATGAGCTT‐3′, (e) ccnd1 fwd 5′ CTGTGCGACAGACGTCAACT‐3′ and rev 5′‐CTGACACGATCGCAGACAGT‐3′, (f) lef1 fwd 5′ ACCCACAGGTGAAACAGGAG‐3′ and rev 5′‐GGCCGAGGATCTGATTGATA‐3′, and (g) col2a1a fwd 5′‐ GTGTGTGATTCGGGGACTGT‐3′ and rev 5′‐TTTGCACCAAGTGACCCGAT‐3′. Analysis was performed at 30 HPF or 54 HPF as indicated in the figure legend.

Castro V.L., Reyes‐Nava N.G., Sanchez B.B., Gonzalez C.G., Paz D, & Quintana A.M. (2020). Activation of WNT signaling restores the facial deficits in a zebrafish with defects in cholesterol metabolism. Genesis (New York, N.y. : 2000), 58(12), e23397.

+ Open protocol

+ Expand

Yeast RNA Extraction and qPCR Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was harvested from yeast cells in exponential growth in YPD broth using the RiboPure RNA purification kit for yeast (Invitrogen AM1924), and then treated with DNaseI. cDNA was synthesized using Verso cDNA synthesis kit (Fisher Scientific AB1453A). Genomic DNA contamination was checked by PCR with primers flanking the intron of C. glabrata ACT1. Primers used throughout the study are listed in Supplementary Table S5^{46 (link),63 (link),64 (link)}. Quantitative PCR with SYBR Green qPCR Master Mix (Fisher Scientific FERK0223) was performed with 1:10 diluted cDNA. Target gene expression was calculated using the ΔΔCT method, with normalization to housekeeping genes ACT1 and Cg18S. Data are shown as mean with standard error of mean (SEM) of at least 3 independent experiments.

+ Open protocol

+ Expand

Quantitative RT-PCR of Myotube RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from myotubes using TRIzol Reagent (Fisher Scientific). First strand cDNA was synthesized from 1 μg of total RNA using the Verso cDNA Synthesis Kit (Fisher Scientific). qPCR was performed in duplicate wells using the LightCycler 480 system (Roche Applied Science) and SYBR Green 1 Master Mix (Roche Applied Science) as follows: 40 cycles of amplification with 10 s at 95°C, 20 s at 60°C and 20 s at 72°C. After amplification, the melting curve was assessed to ensure the presence of a single product. Pooled RNAs were used as a calibrator and Ct values of the target gene were normalized to the Ct values of the house-keeping gene GAPDH. The expression level of each transcript was determined using the 2-ΔΔCt method. Primer sequences are described in Table 1.

Pomiès P., Blaquière M., Maury J., Mercier J., Gouzi F, & Hayot M. (2016). Involvement of the FoxO1/MuRF1/Atrogin-1 Signaling Pathway in the Oxidative Stress-Induced Atrophy of Cultured Chronic Obstructive Pulmonary Disease Myotubes. PLoS ONE, 11(8), e0160092.

+ Open protocol

+ Expand

Comprehensive Bone Marrow Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qRT-PCR experiments, all samples were prepared in biologic triplicate. Whole BM was negatively selected for lineage markers using antibodies conjugated to magnetic beads and separated using EasySep Mouse Hematopoietic Progenitor Cell Isolation Kit (STEMCELL Technologies). Total RNA was isolated using the Trizol (Invitrogen), and cDNA was synthesized using the Verso cDNA Synthesis kit (Fisher). Quantitative PCR was performed using Taqman reagents and probes (Thermo Fisher) for ActinB (Mm02619580_g1), Spi1, (Mm00488140_m1) and Ebf1 (Mm00432948_m1) and FastStart Universal SYBR Green (Sigma) and primers for Stag2 (F: 5’-TGCTATGCAGTCGGTGGTAG-3’) and (R: 5’-AGGACCAGCCATGGTAAGTG-3’), Stag1 (F: 5’-CTACAAGCATGACCGGGACAT-3’) and (R: 5’-AGGGTACTTGTATGCCTAAAAGC-3’), and ActinB (F: 5’-GGCTGTATTCCCCTCCATCG-3’) and (R: 5’-CCAGTTGGTAACAATGCCATGT-3’). For mRNA-Seq analysis, samples were prepared and analyzed in biologic triplicate. For RNA-sequencing, RNA was isolated by Trizol extraction from sorted-cell population or lineage negative bone marrow as indicated. RNA-sequencing libraries were generated by 3’ sequencing and SMART-Seq2 amplification and sequenced on an Illumina NextSeq 500.

Viny A.D., Bowman R.L., Liu Y., Lavallée V.P., Eisman S.E., Xiao W., Durham B.H., Navitski A., Park J., Braunstein S., Alija B., Karzai A., Csete I.S., Witkin M., Azizi E., Baslan T., Ott C.J., Pe’er D., Dekker J., Koche R, & Levine R.L. (2019). Cohesin members Stag1 and Stag2 display distinct roles in chromatin accessibility and topological control of HSC self-renewal and differentiation. Cell stem cell, 25(5), 682-696.e8.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cultured cells and isolated tissues were directly lysed using PureLink Lysis Buffer (Ambion/Life Technologies) and RNA were isolated using a PureLink Isolation kit. For RNA extraction from human acne tissue sections, a total of 30 sections were collected per biopsy and combined for RNA extraction using TRIzol (Thermo Fisher Scientific). Up to 1 μg of RNA was reverse-transcribed to complementary DNA (cDNA) using a Verso cDNA synthesis kit (Fisher Scientific). Quantitative real-time PCR was performed with the CFX96 Real-Time System (Bio-Rad) using SYBR Green Mix (Bimake, Houston, TX). The housekeeping gene Tbp (TATA-binding box protein) or Gapdh was used to normalize gene expression in samples. Specific primer sequences are shown in table S1.

O’Neill A.M., Liggins M.C., Seidman J.S., Do T.H., Li F., Cavagnero K.J., Dokoshi T., Cheng J.Y., Shafiq F., Hata T.R., Gudjonsson J.E., Modlin R.L, & Gallo R.L. (2022). Antimicrobial production by perifollicular dermal preadipocytes is essential to the pathophysiology of acne. Science translational medicine, 14(632), eabh1478.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!