CCF and control samples were isolated by laser microdissection using a Leica LMD 6500 System (Leica Microsystems, Wetzlar, Germany) wiped with RNase AWAY (Molecular Bio Products, San Diego, USA). Sample boxes were thawed 30 minutes on ice before staining the cryosections according to a modified H&E-staining protocol. Briefly: sections were incubated in DEPC-water (0.1% diethyl-pyrocarbonate, Sigma-Aldrich, St. Louis, MO, USA) for ten seconds, stained with hemalaun for 50 seconds, and washed for 10 seconds with DEPC-water before staining with eosin for ten seconds. Slides were then incubated in 90% ethanol for 30 seconds. Material of the same patient and same sample type was collected in one tube and stored on dry ice during collection. For storage, 800µl TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) was added and samples were stored at -80°C. For microarray analysis nine (N=9) and for proteomic analysis seven sample pairs (N=7) were appropriate.
Depc water
Manufactured by Merck Group
Sourced in United States, Germany, China
DEPC water, also known as diethylpyrocarbonate-treated water, is a specialized laboratory reagent used to inactivate RNase enzymes. It is primarily used in molecular biology and biochemistry applications where the preservation of RNA integrity is crucial. DEPC water is produced by treating purified water with diethylpyrocarbonate, a compound that irreversibly binds to and deactivates RNase enzymes.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions)
Trypsin edta, by Thermo Fisher Scientific (4 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Lmd6500 system, by Leica (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (2 mentions)
3 m sodium acetate, by Merck Group (1 mentions)
Nextseq 500, by Illumina (1 mentions)
Bioanalyzer, by Agilent Technologies (1 mentions)
Truseq stranded mrna kit, by Illumina (1 mentions)
Agilent rna 6000 nano kit, by Agilent Technologies (1 mentions)
Reverse reaction kit, by Promega (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Transwell chamber, by Merck Group (1 mentions)
Qsybr green pcr kit, by GenePharma (1 mentions)
Pcr buffer, by Promega (1 mentions)
Annexin 5 fitc apoptosis detection kit, by Promega (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Rt qpcr kit, by Takara Bio (1 mentions)
18 protocols using depc water
1
Laser Microdissection for RNA and Protein Isolation
2
Total RNA Extraction and RNA-seq Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the infected co-cultures was obtained following the manufacturer’s protocol with minor modifications. Briefly, cells lysed in 1 mL of Trizol were mixed with 0.2 mL of chloroform, and then centrifuged at 12,000× g at 4 °C for 15 min. The aqueous phase was transferred to a new tube and mixed again with 0.1 mL of chloroform, and centrifuged at 12,000× g at 4 °C for 5 min. Finally, the RNA was precipitated from the aqueous phase by adding 0.6 mL of isopropanol and 60 μL of 3 M sodium acetate (Sigma-Aldrich, St. Louis, MO, USA). The RNA solution was incubated overnight at −70 °C, and then centrifuged at 12,000× g at 4 °C for 30 min. The pellet was washed with ethanol 70% and the purified RNA was resuspended in 20 μL DEPC water (Sigma-Aldrich, St. Louis, MO, USA). RNA quality and quantity were determined in the Bioanalyzer (Agilent, Santa Clara, CA, USA) instrument using Agilent RNA 6000 Nano Kit. The purified method yielded high quality electropherograms, and the mean value for the RNA integrity Number (RIN) of the six samples was 8.25.
Libraries for RNA sequencing were constructed using the TruSeq Stranded mRNA kit (Illumina, San Diego, CA, USA), and sequenced in the NextSeq500 (Illumina, San Diego, CA, USA) equipment from the Hospital de Niños R. Gutierrez with a 75-cycles Single End kit and 20 M readings per replicate.
Libraries for RNA sequencing were constructed using the TruSeq Stranded mRNA kit (Illumina, San Diego, CA, USA), and sequenced in the NextSeq500 (Illumina, San Diego, CA, USA) equipment from the Hospital de Niños R. Gutierrez with a 75-cycles Single End kit and 20 M readings per replicate.
3
Transcriptional Regulation of Cell Proliferation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reagents for this study included: TRIzol reagent (Thermo Fisher Scientific, USA), citrate buffer (pH=6.0) (Wuhan Boshide Corporation, China), qSYBR Green PCR kit (Shanghai GenePharma, Shanghai, China), reverse reaction kit (Promega, USA), 10×RT buffer (Dalian Bao Biotech Company, China), DEPC water (Sigma-Aldrich, USA), MMLV reverse transcriptase (Dalian Bao Biotech Company, China), 2.5 mM dNTP mixture (Nanjing Kaiji Biotech., China), 10× PCR buffer (Promega, USA), fetal bovine serum (Thermo Fisher Scientific, USA), trypsin/EDTA (Thermo Fisher Scientific, USA), Transwell chamber (Merck, USA), Lipofectamine TM 2000 (Thermo Fisher Scientific, USA), CCK-8 (Tongren Chemical Research Institute, Japan), Annexin V-FITC Apoptosis Detection Kit (Promega, USA), and RPMI-1640 medium (Life Technologies, Gaithersburg, MD).
4
CDKN2B mRNA Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-qPCR was used to detect the CDKN2B mRNA expression. The cells were triturated and lysed. The RNAs were then extracted by CHCl3 (Aladdin, China) and dissolved in DEPC water (Sigma aliquots). Reverse transcription kit (TaKaRa, Japan) was used to synthesize cDNA. The reverse transcription reaction conditions were set at 37°C for 15 minutes, and the reverse transcription inactivation conditions were set at 85°C for 15 seconds. RT-qPCR was performed with the RT-qPCR kit (TaKaRa) by activating the DNA polymerase at 95°C for 5 minutes, followed by 40 cycles of two-step PCR (95°C for 10 seconds and 60°C for 30 seconds) and a final extension at 75°C for 10 minutes, and held at 4°C. RNase-free water was used as the templates of negative control experiences. All primers were obtained from Genewiz (Suzhou, Jiangsu, China) and are listed inTable 1 . The formula 2-ΔΔCT was implemented to determine the mRNA expression levels.
RT-qPCR was used to detect the CDKN2B mRNA expression. The cells were triturated and lysed. The RNAs were then extracted by CHCl3 (Aladdin, China) and dissolved in DEPC water (Sigma aliquots). Reverse transcription kit (TaKaRa, Japan) was used to synthesize cDNA. The reverse transcription reaction conditions were set at 37°C for 15 minutes, and the reverse transcription inactivation conditions were set at 85°C for 15 seconds. RT-qPCR was performed with the RT-qPCR kit (TaKaRa) by activating the DNA polymerase at 95°C for 5 minutes, followed by 40 cycles of two-step PCR (95°C for 10 seconds and 60°C for 30 seconds) and a final extension at 75°C for 10 minutes, and held at 4°C. RNase-free water was used as the templates of negative control experiences. All primers were obtained from Genewiz (Suzhou, Jiangsu, China) and are listed in
The sequences of primers
| Primer name | Sequence (5ʹ-3ʹ) | Product size (bp) |
|---|---|---|
| CDKN2B-Forward | AAGAGTGTCGTTAAGTTTACG | |
| CDKN2B -Reverse | ACATCGGCGATCTAGGTTCCA | 286 |
| GAPDH-Forward | CCATCTTCCAGGAGCGAGAT | |
| GAPDH-Reverse | TGCTGATGATCTTGAGGCTG | 222 |
5
DNA Extraction from Oak Wood Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
800 μl lysis buffer (Table 3 ) were added to each 2 ml tube containing 20–100 mg of wood powder. Tubes were incubated for 4 hours at 4°C or 65°C under 1,300 rpm constant agitation. At the end of the incubation; tubes were centrifuged for 5 minutes at 17,000 g and 4°C. The supernatant was recovered and transferred to a new 2 ml tube. 700 μl of chloroform were added to each tube, tubes were inverted 3 times and centrifuged at 17,000 g and 4°C for 5 minutes. The supernatants were retrieved and transferred to new 2 ml tubes. Two volumes of 99% ethanol were added to each tube. The tubes were inverted 20 times and stored at -20°C for 45 minutes. After the storage at -20°C, the tubes were centrifuged for 10 minutes at 17,000 g and 4°C; the supernatant was discarded. The precipitated DNA was resuspended in DEPC water (Sigma-Aldrich) and DNA concentration was measured by fluorometric quantification (Qubit 3.0 Fluorometer, dsDNA HS assay, ThermoFisher Scientific). In total, DNA was extracted from 427 samples obtained from 7 distinct oak wood cores/cross-section (S1 File ).
6
Quantifying CRYBB2 Isoform Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the relative expression of the empty vector, Wt- and I21N-CRYBB2 in transfected cells, RT-qPCR was performed. Total RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), qPCR SYBR® Green Master Mix (Vazyme Biotech, Co., Ltd.) and the RNA was reverse transcribed into cDNA using a QuantiTect Reverse Transcription kit (cat. no. 205313, Qiagen China Co., Ltd.), according to the manufacturer's protocol. qPCR was performed using a PCR amplifier (26 (link)). The method of gene quantification used was 2-ΔΔCq as previously described (27 (link)). PCR primers were designed by Invitrogen (Thermo Fisher Scientific, Inc.) as follows: CRYBB2 forward, 5'-GTAGCCAGGATTCTGCCATAGGAA-3' and reverse, 5'-GTGCCCTCTGGAGCATTTCATAGT-3'; GAPDH forward, 5'-TTCCGAGTTCCTGTCCCTAATG-3' and reverse, 5'-GCCTCCTTCACCTTCTGCTTG-3'. qPCR was performed using the FTC2000 (Funglyn Biotech). Samples were set up in 50 µl final volumes containing 6 µl 5X PCR buffer, 0.6 µl 2X primers (25 pmol/µl), 0.3 µl probe (25 pmol/µl) or 0.3 µl SYBR-Green, 1 µl dNTPs (10 mM), 0.3 µl Taq enzyme (5 U/µl), 3 µl Mg2+ (25 mM), 1 µl template and 17.2 µl DEPC water (Sigma-Aldrich; Merck KGaA). Thermocycling conditions were as follows: Initial denaturation at 94˚C, followed by 40 cycles of 20 sec at 94˚C and 30 sec at 60˚C. The relative expression was calculated based on the expression of GAPDH.
7
RNA Extraction and RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
With the aim of preventing RNA degradations and contaminations, RNase-free materials and solutions, prepared with diethyl pyrocarbonate (DEPC) water (Sigma-Aldrich), were used for RNA extraction. Total RNA was pulled out by Trizol (Invitrogen-Life Technologies) and successively reverse transcribed using SuperScript VILO kit (Invitrogen). Relative mRNA levels of specific genes of interest were determined by RT-PCR amplification made with iQ SYBR GREEN Supermix (Bio-Rad Laboratories). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene to normalize data through ΔΔCT method. CREB and GAPDH primer sequences are reported as follows: CREB-forward: 5′-CACCTGCCATCACCACTGTAA-3′; CREB-reverse: 5′-GCTGCATTGGTCATGGTTAATGT-3′; GAPDH-forward: 5′-GGAGTCAACGGATTTGGT-3′; GAPDH-reverse: 5′-CTTCCCGTTCTCAGCCTT-3′.
8
Efficient DNA Extraction from Water Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For DNA extraction, aliquots of 250 mL or 500 mL of water were filtered through 0.22 µm nitrocellulose filter membranes (GSWP, Whatman). Filters were stored at − 20 °C (or − 80 °C for longer storage) until use. DNA extraction was performed according to the protocol described in Kisand et al. [34 (link)] except for the lyticase incubation. Briefly, each frozen filter was thawed, incubated in 5 mL of 50 mM KH2PO4 buffer (pH 7.5) and shaken overnight (160 rpm) at 4 °C. The following day, the KH2PO4 buffer was recovered and filters were transferred to a tube with 3 mL of fresh 50 mM KH2PO4 to be sonicated at 60 °C for a total of 15 min. Filters were discarded, and sonicated and not sonicated buffers were pulled together and then shaken for 3 h at 30 °C with 533 µL lysozyme (100 mg/mL in DEPC water, Sigma Aldrich) and 7.7 µL β-mercaptoethanol (Sigma-Aldrich). Samples were frozen at − 20 °C, thawed and centrifuged at 4 °C for 20 min at 14.000 rpm. The DNA was extracted using the DNeasy blood and tissue kit (Qiagen) following the manufacturer’s instructions. DNA was quantified by measurements with both Nanodrop and Qubit (Thermofisher). DNA concentrations measured with the two instruments ranged from 18.6 to 48.6 ng/µL (Nanodrop) and from 13.7 to 48.8 ng/µL (Qubit). Purified DNA samples were subjected to 16S sequencing and shotgun analysis.
9
Targeted RNA Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
“Primers set B” were prepared to final concentrations and stored in stocks of 24 reactions at −20 °C; parallel stocks of 24 tubes containing 20 µL of “lysis buffer” (DEPC water, Sigma-Aldrich, Darmstadt, Germany) were stored at room temperature. For sample processing, one tube of primers and one tube of lysis buffer per sample, plus positive and negative controls, were used in the next steps: (i) in the sample manipulation area, using a microbiological cabinet, 20 µL of the sample was added to “lysis buffer”, then heated at 95 °C for five minutes in a thermal block; (ii) in the clean area, 12.5 µL of WarmStart enzymes was added to the prepared primers; (iii) back in the sample manipulation area, 2.0 µL of boiled sample was added to the primers + enzyme mix, mixed thoroughly and incubated for 40 min at 65 °C in a thermal block. Results of visual and application-assisted detection were recorded as described above.
10
Laser Microdissection and Transcriptomic/Proteomic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CCF and control samples were isolated by laser micro-dissection using a Leica LMD 6500 System (Leica Microsystems, Wetzlar, Germany) wiped with RNase AWAY (Molecular Bio Products, San Diego, CA, USA). Sample boxes were thawed for 30 min on ice before staining the cryosections according to a modified H&E-staining protocol. Briefly: sections were incubated in DEPC-water (0.1% diethyl-pyrocarbonate, Sigma-Aldrich, St. Louis, MO, USA) for ten sec, stained with hemalaun for 50 sec, and washed for 10 sec with DEPC-water before staining with eosin for 10 sec. Slides were then incubated in 90% ethanol for 30 sec.
Material from the same patient and same sample type was collected in one tube and stored on dry ice during collection. For storage, 800 µL TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) was added and samples were stored at −80 °C.
For microarray analysis, nine (N = 9), and for proteomic analysis, seven, sample pairs (N = 7) were of suitable quality.
Material from the same patient and same sample type was collected in one tube and stored on dry ice during collection. For storage, 800 µL TRIzol Reagent (Life Technologies, Carlsbad, CA, USA) was added and samples were stored at −80 °C.
For microarray analysis, nine (N = 9), and for proteomic analysis, seven, sample pairs (N = 7) were of suitable quality.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!