Northern blots were performed to assess specificity of probe target recognition and to estimate target transcript sizes. Twenty micrograms of total RNA isolated from adult whole mouse testes were separated on 1.2% agarose/formaldehyde gels and transferred to Hybond XL membranes (GE Healthcare Life Sciences). Membranes were blocked with ULTRAhyb™ (Ambion, Austin, USA) at 68°C for 1 h prior to hybridization. DIG-labeled riboprobes (100 ng) were hybridized to membranes overnight at 68°C. Membranes were washed first with 0.1× SSC and 0.1% SDS at 68°C, then in maleic acid buffer (0.1 M Maleic acid, 0.15 M NaCl, pH 7.5, 0.3% Tween). One percent (w/v) blocking reagent (Roche Molecular Biochemicals, Basel, Switzerland) in maleic acid buffer was used to further reduce non-specific binding to membranes and to dilute the anti-DIG-alkaline phosphatase conjugate (anti-DIG-AP; Roche Molecular Biochemicals; 1:10,000). Following a 30 min incubation with anti-DIG-AP antibody, the membranes were washed with the maleic acid buffer and exposed to CDP-Star™ (Roche Molecular Biochemicals) detection reagent for 5 min. Chemiluminescent signal was detected on Hyperfilm™ (Amersham Biosciences, Little Chalfont, UK) for <1 h prior to development.
Anti dig ap
Manufactured by Roche
Sourced in Germany, Switzerland
Anti-DIG-AP is a laboratory reagent that binds to the digoxigenin (DIG) label. It is conjugated with the enzyme alkaline phosphatase (AP), which allows for colorimetric or chemiluminescent detection of DIG-labeled molecules.
Automatically generated - may contain errors
Lab products found in correlation
Bm purple, by Roche (7 mentions)
Cdp star, by Roche (4 mentions)
Anti dig pod, by Roche (4 mentions)
Nbt bcip, by Roche (3 mentions)
Dig rna labeling mix, by Roche (3 mentions)
Dig labeling kit, by Roche (2 mentions)
Dig easy hyb, by Roche (2 mentions)
Cspd chemiluminescence, by Roche (2 mentions)
Rneasy plant mini kit, by Qiagen (2 mentions)
Anti flu ap, by Roche (2 mentions)
Blocking reagent, by Roche (2 mentions)
Nbt bcip substrate, by Roche (2 mentions)
T3 or t7 rna polymerase, by Promega (2 mentions)
Ultrahyb, by Thermo Fisher Scientific (2 mentions)
Anti dig pod antibody, by Roche (1 mentions)
Ab3080, by Merck Group (1 mentions)
Alexa fluor 488 labeled anti rabbit igg, by Thermo Fisher Scientific (1 mentions)
Pgem t easy, by Promega (1 mentions)
Ntb bcip, by Merck Group (1 mentions)
Image pro plus, by Media Cybernetics (1 mentions)
53 protocols using anti dig ap
1
Evaluating Transcript Specificity via Northern Blots
2
Examining neural responses to Kiss1 treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Effect of Kiss1 treatment on neural activities in the habenula and dopaminergic neurons were examined by expression of neural activity marker, npas4a expression, which were examined in the brain of AB-wild type or Tg(dat:EGFP) fish, respectively. The whole brain (n = 6 fish/group) was dissected 30-min after the Kiss1 administration and fixed in buffered 4% paraformaldehyde for overnight at 4 °C and then expression of npas4a were examined by in situ hybridization. For npas4a mRNA expression in the habenula, coronal sections (10 µm) (n = 6 for control and Kiss-treated) of wild-type AB male were hybridized with DIG-labelled npas4a riboprobes (737nt, GenBank accession number: NM_001045321) for 16 h at 55 °C. DIG-labelled napas4a mRNA was detected with either anti-DIG-AP or anti-DIG-POD antibody (Roche) followed by chromogenic development with NBT/BCIP or amplification using TSA Plus Cyanine 3 System (Perkin Elmer/AKOYA Biosciences), respectively. After TSA amplification of npas4a mRNA signals, EGFP signals were further enhanced with a rabbit anti-GFP antibody (1:500 dilution, Millipore Cat# AB3080, RRID:AB_91337) followed by incubation with Alexa Fluor 488-labeled anti-rabbit IgG (1:500 dilution, Thermo Fisher Scientific).
3
In situ Hybridization in Cotton Ovaries
Check if the same lab product or an alternative is used in the 5 most similar protocols
In situ hybridization was carried out as described in cotton research previously (Zhang et al., 2017 (link)). Briefly, 0 DPA ovaries of Xu142_LF were collected and embedded in paraffin. 10 μm paraffin sections were de‐paraffinized, rehydrated and incubated overnight with the Dig‐labelled RNA probe (Roche). Sections were then incubated with alkaline phosphatase‐conjugated anti‐digoxigenin (anti‐Dig‐AP, Roche) and the signal was detected by nitro‐blue tetrazolium/5‐bromo‐4‐chloro‐3‐inodyl‐phosphate (NBT/BCIP) colour substrate solution (Roche). Sections incubated with sense RNA probe were used as negative control. Images were captured using fully motorized upright microscope (Leica DM6B) in bright‐field mode. Primers are listed in TableS12 .
+ Expand
In situ hybridization was carried out as described in cotton research previously (Zhang et al., 2017 (link)). Briefly, 0 DPA ovaries of Xu142_LF were collected and embedded in paraffin. 10 μm paraffin sections were de‐paraffinized, rehydrated and incubated overnight with the Dig‐labelled RNA probe (Roche). Sections were then incubated with alkaline phosphatase‐conjugated anti‐digoxigenin (anti‐Dig‐AP, Roche) and the signal was detected by nitro‐blue tetrazolium/5‐bromo‐4‐chloro‐3‐inodyl‐phosphate (NBT/BCIP) colour substrate solution (Roche). Sections incubated with sense RNA probe were used as negative control. Images were captured using fully motorized upright microscope (Leica DM6B) in bright‐field mode. Primers are listed in Table
4
Dig-labeled RNA probes for in situ hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA probes were created from in vitro transcription of PCR products carrying the T7 RNA polymerase recognition sequence at one end and synthesized by using a digoxigenin (Dig)-labeling kit (Roche). Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000; Roche). Primers used for generating PCR templates are listed in Supplementary Table 2 .
5
Preparation of RNA Probes for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
300–500 bp fragments of coding sequence of murine Lfng, Shc3, Dkk3, Daam2 were cloned into pGem®-T easy (Promega) and were used as templates to synthesize digoxigenin-labeled antisense RNA probes according to the manufacturer’s specifications (Roche). Probe hybridization and washes were performed as previously described88 (link). Bound probe was detected with anti-DIG-AP (alkaline phosphatase conjugated) antibody (Roche) followed by a color reaction using the AP substrate BM-Purple (Roche).
6
Whole-mount miRNA detection in mouse inner ear
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Inner ears of P0 C57BL/6 mice were dissected and fixed with 4% paraformaldehyde. Whole mount in situ hybridization analysis was performed using the Exiqon protocol. miRCURY LNA™ microRNA detection custom-made probes, labeled with digoxygenin (DIG) (Exiqon), were used for the detection of novel miRNAs. Probes were hybridized with the tissue, 20-22°C below Tm of the probe. Probes were detected with the anti-DIG-AP (alkaline phosphatase conjugated) antibody (Roche), and the color reaction was developed using the NTB/BCIP (Sigma). The ears were frozen and cryosectioned to 10-18 μm sections and mounted. Images were taken using the Zeiss Aviovert200 M microscope. Three experiments were performed, and 3–5 ears were included in each experiment.
7
In situ Detection of MALAT1 and miR-217
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MALAT1 was detected by in situ hybridization using a DIG-labelled probe, according to the manufacturer’s instructions (DIG application for ISH, ROCHE), and miR-217 using a double fluorescein –labelled probe (Exqion). Briefly, human tissue samples were fixed, embedded in optimal cutting temperature compound (OCT), and sectioned (at a thickness of 10 µm). The sections or PDAC cells were then treated with proteinase K (10 min in 2 mg/ml protease K) before being washed in DEPC-PBS and treated with RNase-free triethanolamine. Hybridization with 100 ng/ml digoxigenin (DIG)-labelled RNA probe or 20 nM fluorescein –labelled probe was performed overnight at 50 °C after prehybridization. For fluorescein –labelled probe, cells were sealed with DAPI. Images were acquired by fluorescence microscopy (Olympus) and overlapped using Image-Pro Plus (Version 6.0.0.260; Media Cybernetics, Inc., Tokyo, Japan). For the DIG-labelled probe, the sections were subsequently incubated with a 1:5000 dilution of anti-DIG-AP (alkaline phosphatase-conjugated; Roche), and 5-bromo-4-chloro-3-indolylphosphate/Nitro-blue tetrazolium was used for the colour reaction. The colour reaction produced a blue precipitate at the hybridization site. MALAT1 positivity was scored as negative (−), weakly or focally positive (1+), or strongly positive (2+).
8
In-Situ Hybridization of miR-125b
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ISH procedure was carried out with miR-125b miRCURY LNA microRNA Detection Probes (Exiqon, Woburn, MA, USA) and a miRCURY LNA microRNA ISH Optimization Kit (FFPE) (Exiqon). The 5′-3′ sequences of probes were TCACAAGTTAGGGTCTCAGGGA, with both 5′ and 3′ ends DIG labeled. The ISH procedure was optimized according to the instruction manual to achieve satisfactory results: a 37°C 15-min incubation of 1 μL/mL proteinase-K, a 56°C 3-h hybridization of 40-nM miR-125b probes and a 4°C 9-h incubation of 1:400 anti-DIG-AP (Roche, Basel, Switzerland) were applied.
Two urologic pathologists (L. Chen and H. Fu) reviewed the staining sections and for every sample, each of them chose a typical field under 10 × 20 magnification independently, without knowing any information about the patients. The score of tumor cores was determined by their deliberation if their two scores were different. Then the arithmetic average of the two scores from the same tumor is determined as a quantification of tumorous miR-125b. A semi-quantitative evaluation was then used: percentages of miR-125b-positive cells were scored from 0 to 100, intensities of staining were scored from 0 to 3 (from low to high, respectively), and the products of percentage × intensity were recorded; the mean point by two pathologists was determined as the final score of that sample.
Two urologic pathologists (L. Chen and H. Fu) reviewed the staining sections and for every sample, each of them chose a typical field under 10 × 20 magnification independently, without knowing any information about the patients. The score of tumor cores was determined by their deliberation if their two scores were different. Then the arithmetic average of the two scores from the same tumor is determined as a quantification of tumorous miR-125b. A semi-quantitative evaluation was then used: percentages of miR-125b-positive cells were scored from 0 to 100, intensities of staining were scored from 0 to 3 (from low to high, respectively), and the products of percentage × intensity were recorded; the mean point by two pathologists was determined as the final score of that sample.
9
Colocalization of mRNA and Protein in Cochlear Whole-Mounts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA (GC-A) and protein (Tuj-1) were colocalized on cochlear whole-mounts, as previously described (Singer et al., 2014 (link)). In brief, following prehybridization for 1 h at 37°C, sections were incubated overnight with GC-A riboprobes (for: 5′-TGT GAA ACG TGT GAA CCG GA-3′ and rev: 5′-AGG CGG ATC GTT GAA AGG G-3′) at 56°C, incubated with anti-digoxigenin antibody conjugated to alkaline phosphatase (anti-Dig-AP, Roche, Germany, 11093274910), and developed as previously described (Singer et al., 2013 (link)). For protein detection, streptavidin–biotin was blocked according to the manufacturer’s instructions (Streptavidin–Biotin Blocking Kit, Vector Laboratories, United States). Sections were incubated overnight at 4°C with the primary antibodies against Tuj-1 (1:500; monoclonal mouse Biozol MMS-435P), followed by incubation with the secondary antibody (1:500; biotinylated goat anti-rabbit, Vector Laboratories, BA-1000), streptavidin–horseradish peroxidase (1:300 in 1% BSA; Vector Laboratories, Burlingame, CA, United States), and chromogenic detection (AEC, 3-amino-9-ethylcarbazole, Vector Laboratories, SK-4200). Sections were cover slipped with gelatin, and analyzed using a BX61 microscope (Olympus, Hamburg, Germany).
10
Detecting Circular RNA ANRIL in Atherosclerosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ RNA hybridization was conducted in formaldehyde-fixed endarterectomy tissues with digoxygenin (DIG)-labelled RNA probes (Roche Life Sciences) against circANRIL (exons 7–5–6; 381 bp) and sense negative control according to ref. 57 (link). Anti-DIG-AP (Roche Life Sciences) was used as secondary antibody and staining was developed with NBT/BCIP solution (Roche Life Sciences). For dot blot analysis (Supplementary Fig. 12 ), RNA was spotted onto a Hybond-N+ membrane (GE Healthcare) and detected using a DIG-labelled probe against circANRIL and the anti-DIG-HRP antibody (PerkinElmer). Immunohistochemical staining of CD68 and SMA was performed using the ImmPRESS HRP Anti-Rabbit and Anti-Mouse Ig Polymere Detection System (Vector Laboratories) and 3,3′-diaminobenzidine52 (link). In situ hybridization and immunohistochemical stainings were performed three times and representative images are shown in the manuscript.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!