Block it rnai designer

Lentiviral pLV-shRNA and pWPXLd plasmids were used to knockdown and overexpress CUEDC2 in AML cells. Two CUEDC2-targeting sequences were designed by BLOCK-iT^™ RNAi Designer from Life Technologies. Sequences of the CUEDC2 shRNA, scrambled RNA and pWPXLd-CUEDC2 are listed in Table S3. The viruses were propagated in HEK293T cells by cotransfecting cells with the corresponding plasmids along with the helper plasmids pSPXA2 and pMD2.G. After 72 h incubation, the supernatant was collected and concentrated by ultracentrifugation.

Stealth™ RNAi siRNA (GACGGAUCUCUGACGACCAUAUCCU) targeting the bovine GPIHBP1 gene open reading frame was designed using BLOCK-iT™ RNAi Designer (Life Technologies, USA) and synthesized by Life Technologies (USA). The Stealth™ RNAi siRNA negative control (Med GC) was purchased from Life Technologies (USA) and used as a control for sequence-independent effects.
One day prior to transfection, cells were seeded without antibiotics and exhibited a density of 80% at the time of transfection. GPIHBP1-siRNA or the Stealth™ RNAi siRNA Negative Control was transfected into bovine primary mammary epithelial cells using the Roche X-treme GENE siRNA Transfection Reagent (Roche, USA) according to the manufacturer’s instructions. Transfection was performed using a 10:1 ratio of the X-treme GENE siRNA Transfection Reagent (µl) to siRNA (µg). Cells were harvested at 48 hours after transfection for mRNA analysis via real-time quantitative PCR.

To design specific small interfering RNA (siRNA) targeting GPI and gp78 (named siGPI and sigp78), several sequences from the human GPI gene were selected using BLOCK-iT™ RNAi Designer (Life Technologies, Carlsbad, CA, USA). The target sequences for GPI siRNA (siGPI: 5′-CCATACGGAAGGGTCTGCATCACAATT-3′), gp78 siRNA (sigp78: 5′-GTCG GCACAAGAACTATCTTT-3′) and negative control siRNA (si-NC: 5′-TTCTCCGAA-CGTGTCACGT-3′) were synthesized by Genepharma Inc (Shanghai, China). SiRNA transfection was performed using Lipofectamine® 2000 (Invitrogen, Carlsbad, CA, USA). According to the sequence of GPI cDNA (NM_001184722.1), we designed the primers 5′-CGGAATTCCA TGGTAGCTCTCTGCAGCCT-3′ (forward) and 5′-CCCTCGAGGTTATTGGACTCTGG CCTCG C-3′ (reverse), and obtained the full length of GPI cDNA by PCR. GPI cDNA was inserted into pcDNA3.1-Flag (Invitrogen) vector and plasmid DNA transfection was performed using Lipofectamine -LTX (Invitrogen). PCI-Neo-gp78/JM20 (plasmid 13303) was purchased from Addgen (Teddington, UK).

For knockdown of Mrs2, BLOCK-iT^TM Pol II miR RNAi Expression Vector Kits (Life technologies) was used. BLOCK-iT RNAi Designer from Life Technologies was used to design four single-stranded DNA oligonucleotides encoding the target pre-miRNA. These vectors are specifically designed to allow expression of miRNA sequences and contain specific miR flanking sequences that allow proper processing of the miRNA. Sequences of pre-miRNA insert in miRNA vectors for knockdown were designed as follow:
5′-GTAGCTACTGATTCCAAGAGTAGTTTTGGCCACTGACTGACTACTCTTGATCAGTAGCTA-3′ (Mrs2 KD #1),
5′-GAATGCTAGCTACTGATTCCAAGTTTTGGCCACTGACTGACTTGGAATCTAGCTAGCATT-3′ (Mrs2 KD #2),
5′-GTGAAGAATGCTAGCTACTGATGTTTTGGCCACTGACTGACATCAGTAGAGCATTCTTCA-3′ (Mrs2 KD #3), and
5′-GTTTGAAGAATGCTAGCTACTGGTTTTGGCCACTGACTGACCAGTAGCTCATTCTTCAAA-3′ (Mrs2 KD #4), respectively.
To identify the cells transfected with microRNA expression vector for Mrs2 knockdown, the sequence coding EmGFP or tagBFP were incorporated into the vectors. The miR RNAi vectors were transfected into cells 3 days prior to the experiments using Lipofectamine LTX (Life technologies) in the experiments except preparation for metabolome analysis.

MiR‐138 target genes were predicted using the TargetScan (http://www.targetscan.org/) and PicTar (http://pictar.mdc-berlin.de/) algorithms. For this study, genes that were predicted by the two methods were defined as potential miR‐138 targets. Small interfering RNAs (siRNAs) against GIT1 and SEMA4C were designed using the BLOCK‐iT RNAi Designer (Life Technologies, Carlsbad, CA, USA) at http://rnaidesigner.lifetechnologies.com/rnaiexpress/and we ordered two or three siRNAs sequences of each gene for the following studies (Table 1).

The coding sequences of CD44 (XM_008002067.1) and serpin family E member 1 (SERPINE1, encoding PAI-1; XM_008018478.1) were amplified and inserted into the EcoRI/BamHI site of the pLVX-DsRed-Monomer-N1 vector.
For CD44 and SERPINE1 knockdown, the shRNA sequences were designed by BLOCK-It RNAi Designer (http://rnaidesigner.lifetechnologies.com/rnaiexpress/insert.do; Life Technologies; Table S1) and inserted into pLVX-shRNA1 vector (TaKaRa, China).
Lentiviral production was carried out using the Lenti-X HTX Packaging Mix (plasmids pLP1, pLP2, and VSV-G) and X-tremeGENE HP DNA Transfection Reagent (Roche, Germany), in line with the lentivirus packaging protocol. After collection, the lentivirus (MOI = 2) was added into Vero E6 cells with polybrene (8 µg/mL) for 8 h. At 48 h post-infection, puromycin was used for positive selection (8 µg/ml, Sigma-Aldrich), this experiment continued for 2 weeks to generate stable cell lines. Cell lines expressing the CD44, PAI-1, and control (scrambled) shRNA vectors were designated shRNA-CD44, shRNA-PAI-1, and shRNA-control, respectively.

Short hairpin RNA (shRNA) sequences targeting Chlorocebus sabaeus NDRG1 were selected with BLOCK-iT RNAi designer (Life Technologies, Carlsbad, CA) (sh1 [GCAGGACATCGAGACTTTACA] and sh2 [CCTACATCCTAACTCGATTT]). Lentiviral particles were then produced. Briefly, 4 × 10⁶ human HEK293T cells were plated on 10-cm dishes for 24 h before they were transfected with 1 μg of the shRNA-containing pLKO.1 vector, 0.25 μg of pMD2.G (envelope-expressing plasmid), and 0.75 μg of psPAX2 (packaging-expressing plasmid). Transfection was performed with 3 volumes of Lipofectamine (microliters) to 1 volume of DNA (micrograms). The medium was replaced after 6 h. Viral particles were collected 48 h after transfection and used to infect MARC-145 cells. The infected cells were selected in medium containing 10 μg/ml puromycin for 1 week.