Sirna duplexes

The siRNA duplexes were purchased from Dharmacon (listed in Table 2). 1.8 million cells were seeded in a 15 cm dish and reverse transfection was performed according to manufacturer’s instructions. 18 hours after the transfection, fresh growth medium was added. 72 hrs after the transfection, the indicated drug treatments were performed and cells were harvested.

Highly purified ovine LH (NIADDK oLH-S-16) was obtained from the National Hormone and Pituitary Program (NHPP), Torrance, CA, USA. Recombinant human (rh) BMP2, BMP4, BMP6, BMP7, TNFα, TGFα and EGF were purchased from R&D systems (Abingdon, UK). Highly purified bovine inhibin A and pro-αC were prepared ‘in house’ from pooled bovine follicular fluid (see below). Treatment solutions were sterilized using 0.2 µm membrane filters before dilution in sterile culture medium to required concentrations. For experiments involving knockdown of endogenous INHA and INSL3, siRNA duplexes against bovine INHA (sense strand: GGGAACUUGUCCUGGCCAAUU; antisense strand: UUGGCCAGGACAAGUUCCCUU) and bovine INSL3 (Sense strand: GGCAAGACCUGCUGACCCUUU; antisense strand: AGGGUCAGCAGGUCUUGCCUU) were custom-designed and synthesized by Dharmacon Thermo Scientific (Lafayette, CO, USA). Controls included cells transfected with a non-silencing control RNAi (NSC3; Dharmacon) as well as cells exposed to transfection reagent only (DharmaFECT 2; Dharmacon). All cell culture experiments were repeated using TC prepared from n = 4 independent batches of follicles.

Cells were reverse transfected with Dharmafect1 (Dharmacon, Lafayette, CO, USA) and a pool of the four individual siRNA-silencing reagents (12.5 nmol/l each, 50 nmol/l total). For western blot analysis, FACS analysis and immunoprecipitation assay cells were transfected in 24- and 6-well plates, respectively, for 72 h. For real-time quantitative PCR analysis, cells were transfected in 96-well plates for 72 h. All siRNA duplexes were purchased from Dharmacon.

Small short interfering RNA (siRNA) was used to transiently silence Ferritin heavy chain 1 (FTH1) and RAPGEF2. To decrease the expression of Ferritin, a pool of three siRNA duplexes (cat# SR301663, Origene Technologies, Rockville, MD) against FTH1 and scramble siRNA (cat# SR30004) were used. To reduce the expression of RapGEF2, a pool of four siRNA duplexes (cat# L-009742-00-0005, Dharmacon, Lafayette, CO) was applied. siRNA were delivered to cells by SiTran Transfection reagent (Origene Technologies). After transfection for 72 hr, cells were treated with cAMP for intracellular labile Fe(II) measurement. Cells in a subset of wells were harvested for RNA and protein extraction and subsequent qRT-PCR and immunoblot assays.