Iscript reverse transcription supermix for qrt pcr

Manufactured by Bio-Rad

Sourced in United States

The IScript Reverse Transcription Supermix for qRT-PCR is a reagent used for the reverse transcription of RNA to cDNA, which can then be used for quantitative real-time PCR (qRT-PCR) analysis. It contains all the necessary components, including reverse transcriptase, RNase inhibitor, and optimized buffer, in a single ready-to-use solution.

Automatically generated - may contain errors

Lab products found in correlation

33 protocols using iscript reverse transcription supermix for qrt pcr

Quantifying RNA Expression Using Direct-zol Extraction

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the livers or cells using the Direct-zol RNA MiniPrep Kit with on-column DNA digestion (Zymo Research, CA, USA) as described previously.¹¹ (link) For mRNA analysis, cDNA was transcribed from total RNA using iScript Reverse Transcription Supermix for qRT-PCR (Bio-Rad, Hercules, CA, USA). Quantitative real-time PCR was performed using iCycler (Bio-Rad). The mean of the quantification cycle (Cq) of all samples was normalized to 18S mRNA expression, and relative expression was calculated by the ΔΔCt method. Primer sequences were the same as we have described previously.¹¹ (link) For miRNA quantification, cDNA synthesis and qRT-PCR were performed from total RNA using TaqMan miRNA assays (Applied Biosystems, USA). Cq of the target miRNA was normalized either with small nucleolar RNA (snoRNA)-202 (mouse) or RNU48 (human) Cq. For detection of pri-miR-155, cDNA was generated using iScript Reverse Transcription Supermix for qRT-PCR (Bio-Rad), and TaqMan primers and probes specific for mmu-pri-miR-155-FAM and mouse GAPDH-fluorescein (FAM) (control) were used (Applied Biosystems, USA). The qPCR, western blot, and in-vitro experiments were performed with independent replicates.

Bala S., Zhuang Y., Nagesh P.T., Catalano D., Zivny A., Wang Y., Xie J., Gao G, & Szabo G. (2023). Therapeutic inhibition of miR-155 attenuates liver fibrosis via STAT3 signaling. Molecular Therapy. Nucleic Acids, 33, 413-427.

+ Open protocol

+ Expand

Gene Expression Analysis of Immune Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from isolated cells (splenocytes, sorted cells) and cerebral cortices (bregma + 2 to − 3 mm) using Tri reagent (MRC, OH). cDNA was synthetized with iScript reverse transcription supermix for qRT-PCR (Bio-Rad). qRT-PCR was conducted with cDNA in duplicate reactions using the Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Scientific). The reactions were performed in 20-μl total volume and incubated at 50 °C for 2 min and then at 95 °C for 10 min followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. All samples were run in triplicate. The relative mRNA level of each gene was normalized to that of the housekeeping gene GAPDH. The sequences of the primers used are shown in Table 1.

Table 1

Sequences of PCR primers used in this study

Gene	Forward	Reverse
CD147	5′-GACACTGGGGAAGAAGAGGC-3′	5′-GCAGTGAGATGGTTTCCCGA-3′
TNF-α	5′-AGTCCGGGCAGGTCTACTTT-3′	5′-ACCCTGAGCCATAATCCCCT-3′
IL-1β	5′-ATGCCACCTTTTGACAGTGATG-3′	5′-GCAGCCCTTCATCTTTTGGG-3′
IL-6	5′-CCTTCCAGGATGAGGACATGA-3′	5′-TGAGTCACAGAGGATGGGCTC-3′
Arg1	5′-TCACCTGAGCTTTGATGTCG-3′	5′- CTGAAAGGAGCCCTGTCTTG-3′
MCP-1	5′-CCCCAAGAAGGAATGGGTCC-3′	5′-GTGCTGAAGACCTTAGGGCA-3′
Ly6C	5′-ACTGTGCCTGCAACCTTGT-3′	5′-GCTGGGCAGGAAGTCTCAAT-3′
CCR2	5′-ATCCACGGCATACTATCAACATC-3′	5′-CAAGGCTCACCATCATCGTAG-3′
iNOS	5′-CAAGCACCTTGGAAGAGGAG-3′	5′- AAGGCCAAACACAGCATACC-3′
GAPDH	5′-GCGAGATCCCGCTAACATCA-3′	5′-CTCGTGGTTCACACCCATCA-3′

Jin R., Zhong W., Liu S, & Li G. (2019). CD147 as a key mediator of the spleen inflammatory response in mice after focal cerebral ischemia. Journal of Neuroinflammation, 16, 198.

+ Open protocol

+ Expand

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from young adult worms using a TRIzol (Life Technologies) chloroform extraction and cDNA was prepared using iScript Reverse Transcription Supermix for qRT-PCR (Bio-Rad). qRT-PCR was used to measure the expression levels of target genes (iTaq Universal SYBR Green Supermix, Bio-Rad) and normalization controls pmp-3 and cdc-42 (TaqMan Gene Expression Assays, Life Technologies). The relative standard curve method was used to calculate gene expression. Primers of target genes are listed in S2 Table.

Bennett C.F., Kwon J.J., Chen C., Russell J., Acosta K., Burnaevskiy N., Crane M.M., Bitto A., Vander Wende H., Simko M., Pineda V., Rossner R., Wasko B.M., Choi H., Chen S., Park S., Jafari G., Sands B., Perez Olsen C., Mendenhall A.R., Morgan P.G, & Kaeberlein M. (2017). Transaldolase inhibition impairs mitochondrial respiration and induces a starvation-like longevity response in Caenorhabditis elegans. PLoS Genetics, 13(3), e1006695.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis from Liver and Skeletal Muscle Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Approximately 50 mg of liver tissue was homogenized in 1 mL TRIzol and RNA extracted using the RNeasy Plus Universal Mini Kit (Qiagen, Germantown, MD, USA #73404). Approximately 70 mg of skeletal muscle tissue was homogenized and RNA extracted using the TRIzol™ Reagent (Invitrogen ThermoFisher Scientific, Waltham, MA, USA #15596026) according to the manufacturer’s protocol. RNA quality and concentration were measured using a Nanodrop spectrophotometer (ND-1000; Thermo Scientific). cDNA was synthesized from 1 μg of RNA using iScript Reverse Transcription Supermix for qRT-PCR (BioRad, Berkeley, CA, USA #1708840) with a Veriti 96-well Thermal Cycler (Applied Biosystems, Watham, MA, USA) and the following run protocol, 25 °C for 5 min, 46 °C for 20 min, 95 °C for 1 min. Liver cDNA was diluted 1:4 in ddH2O. Skeletal muscle cDNA was not diluted.

Favorit V., Hood W.R., Kavazis A.N., Villamediana P., Yap K.N., Parry H.A, & Skibiel A.L. (2021). Mitochondrial Bioenergetics of Extramammary Tissues in Lactating Dairy Cattle. Animals : an Open Access Journal from MDPI, 11(9), 2647.

+ Open protocol

+ Expand

Quantitative RT-PCR Assay for CHEK1 and RAD54L

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA is isolated by using RNeasy mini kit (QIAGEN) according to the manufacturer's instructions. RNA concentration is determined using a Nanodrop 2000 (Thermo Scientific). cDNA is synthesized by using iScript reverse transcription supermix for qRT-PCR (Bio-rad) according to the manufacturer's protocol. The reverse-transcribed cDNA is analyzed by quantitative RT-PCR (qRT-PCR), and 18S is used as an internal control. Each qRT-PCR includes a 10-μl reaction mixture per well that includes 2.5 μl cDNA, 0.5 μl forward primer (0.5 μM), 0.5 μl reverse primer (0.5 μM), 1.5 μl of DNase/RNase-free distilled water, and 5 μl SYBR green reagent (QIAGEN). The following cycles are performed during DNA amplification: 94°C for 2 minutes, 40 cycles of 94°C (30 seconds), 60°C (30 seconds), and 72°C (40 seconds). 18S is used as an internal control. The primer sequences are showed below: CHEK1 forward: TCATCCATTTCTAACAAATTCACTT, CHEK1 reverse: TGGGCTATCAATGGAAGAAAA, RAD54L forward: GAGCCCAGAGGACCTTGATA, RAD54L reverse: AACCACCTTGTCTGGACAGC, 18S forward: GGCCCTGTAATTGGAATGAGTC and 18S reverse: CCAAGATCCAACTACGAGCTT.

Bai X., Wang J., Huo L., Xie Y., Xie W., Xu G, & Wang M. (2017). Serine/Threonine Kinase CHEK1-Dependent Transcriptional Regulation of RAD54L Promotes Proliferation and Radio Resistance in Glioblastoma. Translational Oncology, 11(1), 140-146.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using the standard Trizol (Invitrogen, Carlsbad, CA) protocol following the manufacturer’s instructions. Reverse Transcription was performed with 1μg RNA using iScript™ Reverse Transcription Supermix for qRT-PCR (BIO-RAD, Hercules, CA, USA). Regular PCR reactions were performed using Fast Start Taq dNTPack (Roche Diagnostics, IN, USA). Quantitative real-time PCR reactions were performed using iTaq Universal SYBR Green Supermix (BIO-RAD, Hercules, CA, USA) using the CFX Connect™ Real-Time PCR Detection System (BIO-RAD). Primer sets used for the study are listed in Table 1. For regular PCR, amplified cDNA was resolved on EtBr containing 2% agarose gels. For real-time PCR mean Ct values of the target genes were normalized to mean Ct values of one or more the housekeeping control genes (Ribosomal protein large 13 A (RPL13A), β Actin, Peptidylprolyl Isomerase A (PPIA) and Hypoxanthine phosphoribosyltransferase 1 (HPRT1)) [-ΔCt = Ct (housekeeping gene) – Ct (target gene)]. The ratio of mRNA expression of target genes versus the housekeeping gene was defined as 2(-ΔCt). Melting curve analysis was performed to check the specificity of the amplified product.

Awaji M., Saxena S., Wu L., Prajapati D.R., Purohit A., Varney M.L., Kumar S., Rachagani S., Ly Q.P., Jain M., Batra S.K, & Singh R.K. (2020). CXCR2 signaling promotes secretory cancer-associated fibroblasts in pancreatic ductal adenocarcinoma. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(7), 9405-9418.

+ Open protocol

+ Expand

Quantitative Analysis of CDK2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA is isolated by using RNeasy mini kit (QIAGEN) according to the manufacturer's instructions. RNA concentration is determined using a Nanodrop 2000 (Thermo scientific). cDNA is synthesized by using iScript reverse transcription supermix for qRT-PCR (Bio-rad) according to the manufacturer's protocol. The reverse-transcribed cDNA is analyzed by quantitative RT-PCR (qRT-PCR), and GAPDH or 18 s is used as an internal control. Each qRT-PCR includes a 10 μl reaction mixture per well that includes 2.5 μl cDNA, 0.5 μl forward primer (0.5 μM), 0.5 μl reverse primer (0.5 μM), 1.5 μl of DNase/RNase-free distilled water, and 5 μl SYBR green reagent (QIAGEN). The following cycles are performed during DNA amplification: 94 °C for 2 min, 40 cycles of 94 °C (30 s), 60 °C (30 s), and 72 °C (40 s).18S is used as an internal control. The primer sequences are showed below: CDK2-Forward: GAATCTCCAGGGAATAGGGC, CDK2-Reverse: CTGAAATCCTCCTGGGCTG, 18S-Forward: GGCCCTGTAATTGGAATGAGTC and 18S-Reverse: CCAAGATCCAACTACGAGCTT.

Wang J., Yang T., Xu G., Liu H., Ren C., Xie W, & Wang M. (2016). Cyclin-Dependent Kinase 2 Promotes Tumor Proliferation and Induces Radio Resistance in Glioblastoma. Translational Oncology, 9(6), 548-556.

+ Open protocol

+ Expand

HPV16 E6 Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell lines [Tal3, TC-1 (positive control) and HEK293 (negative control)] were cultured in vitro and lysed in TRIzol. Cellular RNA was isolated using Direst-zol MicroPrep Kit (Zymogen) and cDNA was made using iScript Reverse Transcription Supermix for qRT-PCR (Bio-Rad) according to the supplied protocols. Gene transcript was amplified using the isolated RNA as a template and HPV16 E6 primers (forward, ACAAACCGTTGTGTGATTTGTT; reverse, CAGTGGCTTTTGACAGTTAATACA) with a Touchdown qPCR assay, as described previously (31 (link)). Subsequently, 1 μL of qPCR product was transferred to a 1% agarose gel with 0.01% ethidium bromide and run at 130V for 45 minutes. Resultant bands were visualized using the ChemiDoc Touch Imaging System (Bio-Rad).

Henkle T.R., Lam B., Kung Y.J., Lin J., Tseng S.H., Ferrall L., Xing D., Hung C.F, & Wu T.C. (2021). Development of a Novel Mouse Model of Spontaneous High-Risk HPVE6/E7–Expressing Carcinoma in the Cervicovaginal Tract. Cancer Research, 81(17), 4560-4569.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA is isolated by using RNeasy mini kit (QIAGEN) according to the manufacturer’s instructions. RNA concentration is determined using a Nanodrop 2000 (Thermo scientific). cDNA is synthesized by using iScript reverse transcription supermix for qRT-PCR (Bio-rad) according to the manufacturer’s protocol. The reverse-transcribed cDNA is analyzed by quantitative RT-PCR (qRT-PCR), and 18S is used as an internal control. Each qRT-PCR includes a 10 μL reaction mixture per well that includes 2.5 μL cDNA, 0.5 μL forward primer (0.5 μM), 0.5 μL reverse primer (0.5 μM), 1.5 μL of DNase/RNase-free distilled water, and 5 μL SYBR green reagent (QIAGEN). The following cycles are performed during DNA amplification: 94°C for 2 min, 40 cycles of 94°C (30 s), 60°C (30 s), and 72°C (40 s). 18S is used as an internal control. The primer sequences are showed below: TTK-Forward: GATTGCCACTGTTTCTGGTT, TTK-Reverse: AACCCTGAAGAATAAAACGGA, MTFR2-Forward: GAAACTGGATCCCAATGTGAA, MTFR2-Reverse: GAATAAGGTTAAGCTTCGTGCAA, CD133-forward: ACTCCCATAAAGCTGGACCCC, CD133-reverse: TCAATTTTGGATTCATATGCCTT, 18S-Forward: GGCCCTGTAATTGGAATGAGTC and 18S-Reverse: CCAAGATCCAACTACGAGCTT.

Wang J., Xie Y., Bai X., Wang N., Yu H., Deng Z., Lian M., Yu S., Liu H., Xie W, & Wang M. (2017). Targeting dual specificity protein kinase TTK attenuates tumorigenesis of glioblastoma. Oncotarget, 9(3), 3081-3088.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of HER2 in Metastatic Breast Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 19

Total RNA was extracted from the 21MT-1 metastatic breast cancer cell line at 72 hours post transfection using Trizol (Life Technologies) and following standard RNA extraction protocol. RNA quantity and quality was assessed by a NanoDrop (Thermo Scientific) UV/VIS spectrophotometer, cDNA was made with iScript Reverse Transcription Supermix for qRT-PCR (Bio-Rad), and a RealPlex thermocycler (Eppendorf) was used to create cDNA (5 min 25° C., 30 min 42° C., 5 min 85° C.). Following cDNA creation, qRT-PCR was performed by using the SYBR Green Master Mix (Life Technologies), and a per-reaction use of 500 nM of both the forward and reverse primers with 10 ng of cDNA. The qRT-PCR was performed with a 40 cycle amplification (95° C. for 10 seconds, 56° C. for 30 seconds, and 72° C. for 30 seconds) and a threshold intensity of 50 (during linear phase). The primers used for the qRT-PCR analysis are as follows:

Human GAPDH:

(SEQ ID NO: 1)

(R: 5′-AGG-GGC-CAT-CCA-CAG-TCT-TC-3′);

(SEQ ID NO: 2)

(F: 5′-AGA-AGG-CTG-GGG-CTC-ATT-TG-3′)

Human HER2:

(SEQ ID NO: 3)

(R: 5′-TGA-TGA-GGA-TCC-CAA-AGA-CC-3′);

(SEQ ID NO: 4)

(F: 5′-AAC-TGC-ACC-CAC-TCC-TGT-GT-3′).

The ΔΔCt Method was used to calculate changes in gene expression, and at least three biological samples were analyzed.

US11202838B2. Substrate delivery of embedded liposomes (2021-12-21). NUtech Ventures [US]. Inventors: Srivatsan Kidambi [US], Stephen L. Hayward [US].

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!