Retroscript cdna synthesis kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The RETROscript cDNA synthesis kit is a tool used for the reverse transcription of RNA to complementary DNA (cDNA). The kit provides the necessary reagents and protocols to convert RNA into single-stranded cDNA, which can then be used for various downstream applications such as real-time PCR, gene expression analysis, and library preparation.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (5 mentions) Sybr green pcr master mix, by Bio-Rad (5 mentions) 2100 bioanalyzer, by Agilent Technologies (2 mentions) Icycler iq detection system, by Bio-Rad (1 mentions) 7900ht fast real time pcr, by Thermo Fisher Scientific (1 mentions) Itaq universal sybrr green supermix, by Bio-Rad (1 mentions)

Spelling variants of this product

CDNA synthesis kit (1264 citations) RETROscript kit (183 citations) Retroscript (29 citations) CDNA kits (3 citations)

6 protocols using retroscript cdna synthesis kit

Quantitative Analysis of Neuroglobin Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the TRIzol reagent (Life Technologies, U.S.A.). Five hundred nanograms of total RNA was reverse transcribed using the RETROScript cDNA synthesis kit (Life Technologies, U.S.A.).
Real-time PCR was performed using 7900HT Fast Real Time PCR by Applied Biosystems, the iTaqTM Universal SYBRR Green Supermix (Biorad) a Bio-Rad iQ iCycler detection system with SYBR green fluorophore. A melting curve analysis was made after each run to ensure a single amplified product for every reaction. All reactions were run at least in triplicate for each sample. Primers to study NGB expression were as follows NGB-Forward: 5′-TGGAAGACCTGTCCTCACTG-3′ and NGB-Reverse: 5′-GAGCAGAGACTCACCCACTG-3′ (Zhang et al., 2011 (link)). Gene expression was normalized using specific amplification of 18S.

Guglielmotto M., Reineri S., Iannello A., Ferrero G., Vanzan L., Miano V., Ricci L., Tamagno E., De Bortoli M, & Cutrupi S. (2016). E2 Regulates Epigenetic Signature on Neuroglobin Enhancer-Promoter in Neuronal Cells. Frontiers in Cellular Neuroscience, 10, 147.

+ Open protocol

+ Expand

Cytokine and Chemokine Expression Profiling by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using TRIzol reagent as per the manufacturer’s instructions and used for cDNA synthesis using random decamers and a RETROscript cDNA synthesis kit (Life Technologies; Thermo Fisher Scientific, Waltham, MA, USA). Expression of cytokines and chemokines was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using SYBR Green PCR Master Mix (Bio-Rad Laboratories Inc., Hercules, CA, USA) using the gene-specific primers listed below and normalized to GAPDH expression. The primers used are: IL-8F 5′ ACC ACA CTG CGC CAA CAC AGA AAT 3′, IL-8R 5′ AAA CTT CTC CAC AAC CCT CTG CAC 3′, CXCL1 F 5′ TCC AAA GTG TGA ACG TGA AGT CCC 3′, CXCL1 R 5′ CAA GCT TTC CGC CCA TTC TTG AGT 3′, TGFβ F 5′ CGA GAG GAG CGA CGA AGA GT 3′, TGFβ R 5′ AGG GCG GCA TGT CTA TTT TG 3′, CCL5F 5′ TTT CTA CAC CAG TGG CAA GTG CTC 3′, CCL5 R 5′ TCT TCT CTG GGT TGG CAC ACA CTT 3′, IL-6F 5′ TGT GAA AGC AGC AAA GAG GCA CTG 3′, IL-6R 5′ CAC CAG GCA AGT CTC CTC ATT GAA 3′, IP-10F 5′ ACC GTA CGC TGT ACC TGC AT 3′, IP-10R 5′ TCT TGA TGG CCT TCG ATT CT 3′, GAPDH 5′ TCG ACA GTC AGC CGC ATC TTC TTT 3′, and GAPDH R 5′ ACC AAA TCC GTT GAC TCC GAC CTT 3′.

Mukherjee S., Siddiqui M.A., Dayal S., Ayoub Y.Z, & Malathi K. (2014). Epigallocatechin-3-gallate suppresses proinflammatory cytokines and chemokines induced by Toll-like receptor 9 agonists in prostate cancer cells. Journal of Inflammation Research, 7, 89-101.

+ Open protocol

+ Expand

RNA Isolation, cDNA Synthesis, and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions and resolved on RNA chips using a Bioanalyzer 2100 (Agilent Technologies) as described previously (62 (link)). Reverse transcription and cDNA synthesis were performed using random decamers and a Retroscript cDNA synthesis kit (Life Technologies; Thermo Fisher Scientific). Gene expression was determined by quantitative reverse transcription PCR (qRT-PCR) using SYBR green PCR master mix (Bio-Rad Laboratories Inc., Hercules, CA, USA) with gene-specific primers (Table 3) and normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) expression.

Manivannan P., Siddiqui M.A, & Malathi K. (2020). RNase L Amplifies Interferon Signaling by Inducing Protein Kinase R-Mediated Antiviral Stress Granules. Journal of Virology, 94(13), e00205-20.

+ Open protocol

+ Expand

Androgen-responsive gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using Trizol reagent (Invitrogen, Thermo Fisher Scientific,) as per the manufacturer’s instructions and used for cDNA synthesis using random decamers and a RETROscript cDNA synthesis kit (Life Technologies; Thermo Fisher Scientific). Expression of androgen-responsive genes was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using SYBR Green PCR Master Mix (Bio-Rad Laboratories Inc., Hercules, CA, USA) using the gene-specific primers and normalized to GAPDH expression. Primer sequences used are listed in Table 2 below. Experiments were performed in triplicate, and the results are representative of three independent experiments and shown as ± SD.

Dayal S., Zhou J., Manivannan P., Siddiqui M.A., Ahmad O.F., Clark M., Awadia S., Garcia-Mata R., Shemshedini L, & Malathi K. (2017). RNase L Suppresses Androgen Receptor Signaling, Cell Migration and Matrix Metalloproteinase Activity in Prostate Cancer Cells. International Journal of Molecular Sciences, 18(3), 529.

+ Open protocol

+ Expand

Quantitative RT-PCR for DRAK1 and DRAK2 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using Trizol reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) as per the manufacturer’s instructions and used for cDNA synthesis using random decamers and a RETROscript cDNA synthesis kit (Life Technologies; Thermo Fisher Scientific). Expression of DRAK1 and DRAK2 mRNA was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using SYBR Green PCR Master Mix (Bio-Rad Laboratories Inc., Hercules, CA, USA) using the gene-specific primers and normalized to GAPDH expression. Primer sequences used are:

DRAK1-F 5′ TGCTGTGTGAACCTGTCAAAGCAC 3′

DRAK1-R 5′ACCTGGTTGTCTGAAGTGCCTGAT 3′

DRAK2-F 5′AAAAATAGGGCATGCGTGTGA 3′

DRAK2- R 5′ CATAGTTCAGGATTTCTGGAGCTAAA 3′

GAPDH F 5′ GCAAATTCCATGGCACCGT 3′

GAPDH R 5′ TCGCCCCACTTGATTTTGG 3′

Manivannan P., Reddy V., Mukherjee S., Clark K.N, & Malathi K. (2019). RNase L Induces Expression of A Novel Serine/Threonine Protein Kinase, DRAK1, to Promote Apoptosis. International Journal of Molecular Sciences, 20(14), 3535.

+ Open protocol

+ Expand

Quantitative Analysis of Small RNA Cleavage

Check if the same lab product or an alternative is used in the 5 most similar protocols

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
The copyright holder for this preprint this version posted February 9, 2020. ; https://doi.org/10.1101/2020.02.07.939645 doi: bioRxiv preprint Total RNA was isolated from cells using Trizol reagent (Invitrogen), as per manufacture instructions and resolved on RNA chips using Bioanalyzer 2100 (Agilent Technologies) as described previously (71) . RNase L cleaved small RNAs, CIP treated RNase L-cleaved small RNAs and control small RNAs were purified as described earlier (46, 71) . Reverse transcription and cDNA synthesis was performed using random decamers and a RETROscript cDNA synthesis kit (Life Technologies; Thermo Fisher Scientific). Gene expression was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using SYBR Green PCR Master Mix (Bio-Rad Laboratories Inc., Hercules, CA, USA) using the gene-specific primers (Table 2, supplementary data) and normalized to GAPDH expression.

Manivannan P., Siddiqui M.A., & Malathi K. (2020). RNase L amplifies Interferon signaling by inducing PKR-mediated antiviral stress granules.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!