ZNF154 cDNA from healthy human leukocytes was inserted into a lentiviral backbone containing a puromycin selection cassette and three tag proteins Myc. The amplified ZNF154 cDNA was cloned into the psin vector, which was kindly provided by Dr. Yuan-Zhong Wu (Department of Experimental Research, Sun Yat-sen University). Briefly, the psin vector was digested with BstBI (NEB, Beijing, China) and the ZNF154 fragment was inserted via homologous recombination (Vazyme). The ESCC cells were transduced with the lentivirus, and the stably infected cells were selected by three days of puromycin selection (1 µg/mL). The primers used for cloning are listed in Supplementary Table 3 .
Bstbi
Manufactured by New England Biolabs
Sourced in United States, China
BstBI is a type II restriction enzyme that recognizes and cleaves the palindromic DNA sequence 5'-TTCGAA-3' and its reverse complement. It is commonly used in molecular biology research for DNA manipulation and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Transcriptaid t7 high yield transcription kit, by Thermo Fisher Scientific (2 mentions)
Matchmaker gold yeast one hybrid system, by Takara Bio (2 mentions)
T4 dna ligase, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Calcium phosphate method, by Takara Bio (1 mentions)
Klenow fragment, by New England Biolabs (1 mentions)
Nebuilder hifi dna assembly master mix, by New England Biolabs (1 mentions)
Gelred, by Biotium (1 mentions)
Redextract n amp tissue pcr kit, by Merck Group (1 mentions)
Experion automated electrophoresis system, by Bio-Rad (1 mentions)
Genopure plasmid maxi kit, by Roche (1 mentions)
Snabi, by New England Biolabs (1 mentions)
Dh5α competent cells, by Thermo Fisher Scientific (1 mentions)
Sacii, by New England Biolabs (1 mentions)
Gel purification kit, by Zymo Research (1 mentions)
Dna clean and concentrate kit, by Zymo Research (1 mentions)
Noti hf, by New England Biolabs (1 mentions)
10 beta competent e coli, by New England Biolabs (1 mentions)
Q5 hot start high fidelity 2x master mix, by New England Biolabs (1 mentions)
Xbai, by New England Biolabs (1 mentions)
16 protocols using bstbi
1
Generation of ZNF154 Overexpression Cells
2
Engineered Exosome Producer Lentivirus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The exosome producer third-generation Lentivirus plasmid was custom built by VectorBuilder. Inc., which contained a hPGK1 promoter driving expression of CD63-L7Ae and Connexin43 S368A and EF1α promoter driving ZFP362-PAM- C/Dbox expression. The inclusion of protease cleavage site P2A between CD63-L7Ae and Connexin43 S368A ensured protein separation. Mutations in the bovine growth hormone polyadenylation (bgh-PolyA) transcription termination signal after CD63-L7Ae and Connexin43 S368A enable read-through and expression of complete lentiviral genomic RNA expressed from the RSV promoter. The faulty poly (A) signal allowed for CD63-L7Ae and Connexin43 S368A expression. To obtain pLV-EXOtic-ZFP, DNA fragment between Afe1 and Acc65I i.e., PAMt was removed, overhangs filled in using Klenow Fragment (NEB) and re-ligated. To build the pLV-EXOtic-nLuc vector, the pLV-EXOtic-ZPAMt vector was digested with NsiI and BstBI (NEB) to remove the ZPAMt and replaced with the nLuc gene using NEBuilder HiFi DNA Assembly Master Mix (NEB) according to the manufacturer’s instructions. The calcium phosphate method (Takara) was used to transfected HEK 293 T cells with a mixture of genome transfer plasmid and packaging plasmid: pRRE, pCMV.Rev, pMD2.G61 (link), at a ratio of 4:2:1:162 (link). The lentivirus vector was used at an MOI of 5 to transduce Mesenchymal Stem cells via spinoculation.
3
Genotyping Kcnt1 Mutation in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animals were toe-clipped at P8–P12 for identification, and the tip of the tail was biopsied for genotyping. DNA extraction was performed using the REDExtract-N-Amp Tissue PCR Kit (Merck Sigma).
The following PCR primers were used to amplify exon 24 of Kcnt1: Forward 5′-CCACCCAGTTATGACCACAG-3′ and Reverse: 5′-GCTGTAGGTATCTGTTAGCAG-3′.
PCR products were digested with the restriction enzyme BstBI (New England BioLabs), and the products were separated through electrophoresis on a 2% agarose gel stained with GelRed (Biotium). The wild-type allele generated a single fragment of 460 bp, and the mutant allele generated 2 fragments of 276 and 184 bp.
The following PCR primers were used to amplify exon 24 of Kcnt1: Forward 5′-CCACCCAGTTATGACCACAG-3′ and Reverse: 5′-GCTGTAGGTATCTGTTAGCAG-3′.
PCR products were digested with the restriction enzyme BstBI (New England BioLabs), and the products were separated through electrophoresis on a 2% agarose gel stained with GelRed (Biotium). The wild-type allele generated a single fragment of 460 bp, and the mutant allele generated 2 fragments of 276 and 184 bp.
4
Plasmid Linearization and In Vitro Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid pcDNA3.1-MILIP was constructed by Tolo Biotechnology. The plasmids were linearized by restriction enzyme BstBI (New England biolab) and in vitro transcription was then performed using TranscriptAid T7 High Yield Transcription Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.
5
AT1R Promoter DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA methylation within the AT1R promoter was analyzed from the left ventricle of each lamb (ABW, n = 13; LBW, n = 8) by combined bisulfite restriction assay (COBRA) (Xiong and Laird 1997 (link); Zhang et al. 2010 (link), 2013 (link); Wang et al. 2011 (link)). DNA (∼2 μg) from individual hearts was subjected to bisulfite conversion (Epitect, Qiagen, Chadstone Centre, VIC, Australia). PCR was performed on 100 ng of bisulfite-converted DNA using primers and conditions that amplified methylated and unmethylated templates with no bias. Forward primer was 5′-GATGGTTGTGGTATTATTTTTTTT-3′ and reverse primer was 5′-TCTAAAACAACTCCAAATTTATAAC-3′. The amplicon of a 168 bp fragment derived from the promoter (http://genome.ucsc.edu/ , −175 ∼ −8 bp relative to the transcription start site) was examined and digested with BstBI or TailI (New England Biolabs, Ipswich, MA). The intensity of uncut and cut fragments was quantified using an Experion Automated Electrophoresis System (Bio-Rad Laboratories, Gladesville, NSW, Australia). Percentage of methylation at 2 CpG sites was estimated by measuring the ratio of cut to uncut PCR product. The percentage of methylation was validated using methylation standard controls (e.g. 0%, 50%, and 100%).
6
Construction of CD19-Targeting CAR Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The VHH-based CD19-redirected CAR cassette contained the coding sequences for a CD19-specific VHH along with CD8α, followed by the 4-1BB costimulatory domain and the CD3ζ signaling domain, all of which were synthesized by Genscript (Piscataway, NJ, USA). This construct was PCR-amplified using the following oligonucleotide primers 5’ GCTAGCATGGCCTTACCAGTG 3’ and 5’ TTCGAACTAGCGAGGGGGCAG 3’ as forward and reverse primers, respectively. The forward and reverse primers were designed to introduce NheI (New England Biolabs, MA, USA) and BstbI (New England Biolabs, MA, USA) restriction sites at the 5’ and 3’ end of the CAR construct, respectively. The resultant CAR construct was subcloned into the pLJM1-EGFP vector using the mentioned restriction enzymes and T4 DNA ligase (Thermo Fisher Scientific, MA, USA). Finally, plasmid extraction was carried out using the Geno pure Plasmid Maxi Kit (Roche; Cat No. #03143422001) as an endotoxin-free kit for large-scale plasmid DNA isolation with sufficient high-quality.
7
Cloning and Expressing GAD65 and H3N2 HA Reactive TCRs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The GAD65 reactive TCR expression construct was described in Ref. [29 (link)]. The sequence for the H3N2 HA reactive TCR HA1.7 was obtained from the NCBI nucleotide database: GenBank accession number X63455.1 (TCRα), and X63456.1 (TCRβ), as deposited by Hewitt et al. [30 (link)]. The variable TCRα and TCRβ chains were ordered as separate gBlocks (IDT), or with both the TCRα and TCRβ sequence in the same gBlock, containing 5′ and 3′ adaptors with respective restriction sites, and sequentially cloned into the TCR-pMSCVII-Ametrine (TCR-pMIA) plasmid [29 (link)]. Briefly, the TCRα gBlock and vector were digested with SnaBI and SacII (both New England Biolabs), and the digested gBlock product was purified with a DNA clean and concentrate kit (Zymo Research), while the digested TCR-pMIA plasmid was run on an agarose gel and the correct band purified with a gel purification kit (Zymo Research). The purified insert and plasmid backbone were ligated, and the product expanded in DH5α competent cells (Invitrogen). The insert was confirmed by sequencing, and subsequently the TCRβ was cloned into the vector by restriction digestion using MfeI and BstbI (both New England Biolabs), using the same setup as for the cloning of the TCRα chain.
8
Yeast One-Hybrid Assay for BrRGF6 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The upstream promoter of the BrRGF6 gene (PBrRGF6) was amplified using leaf DNA of “SN742” (using the primers shown in Table S1 ), and the promoter elements were analyzed using Plantcare (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ ). PBrRGF6 was amplified (using the primers shown in Table S1 ) and cloned into the HindIII and XhoI sites of vector pAbAi to obtain recombinant vector pPBrRGF6-AbAi. Next, pPBrRGF6-AbAi was linearized using BstbI (NEB, Beijing, China) and transferred into the Y1H strain. The positive yeast Y1H-pPBrRGF6-AbAi was transferred to SD/-Ura/AbA (50–500 ng/mL) and screened for the minimum inhibitory concentration of AbA (AbAr) in relation to yeast growth for a Y1H assay.
The recombinant vector pGADT7-BrNF-YC was transferred to yeast strain Y1H-pPBrRGF6-AbAi. 5 μL of the strain at different dilution concentrations (× 100, × 10−1, × 10−2, × 10−3) was dropped on SD/−Leu and SD/−Leu/AbAr media to verify the binding between BrNF-YC and PBrRGF6. At the same time, pGADT7-T was used as a negative control..
The recombinant vector pGADT7-BrNF-YC was transferred to yeast strain Y1H-pPBrRGF6-AbAi. 5 μL of the strain at different dilution concentrations (× 100, × 10−1, × 10−2, × 10−3) was dropped on SD/−Leu and SD/−Leu/AbAr media to verify the binding between BrNF-YC and PBrRGF6. At the same time, pGADT7-T was used as a negative control..
9
ADAR1 and ADAR2 Mutant Constructs Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequences for the ADAR1 p110 isoform and ADAR1 p150 isoform were amplified from the constructs previously generated in our lab (Bahn et al., 2015 (link)) and cloned into the pcDNA4-TO-FLAG-myc-His vector (Invitrogen) using restriction enzymes NotI-HF (NEB) and BstBI (NEB). ADAR2 mutant constructs (EAA, E396A, and E488Q) were generated by introducing the recoding mutations to the pcDNA4-ADAR2-WT construct previously generated in our lab (Tran et al., 2019 (link)). In general, the ADAR2 coding sequences were reamplified to introduce mutations using overlap extension PCR, followed by digestion and ligation into the pcDNA4-TO-FLAG-myc-His vector via the restriction enzymes NotI-HF (NEB) and XbaI (NEB). All PCR reactions were performed using the Q5® Hot Start High-Fidelity 2X Master Mix (NEB). The primers used for PCR reactions are listed in Table S1 . NEB 10-beta Competent E.coli were used for plasmid construction.
10
Plasmid Assembly Efficiency Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid concentrations were determined with a spectrophotometer (NanoDrop, Thermo Fisher Scientific). A DNA mixture containing 125 fmol of each of the seven plasmids (4.4 μg DNA in total) was digested in a 50 μl reaction containing 50 U of the restriction enzyme BstBI (New England Biolabs). The digest was incubated at 50°C for 30 min. Next, 50 μl of 2X NEBuilder HiFi Assembly Master Mix was added. The reaction was briefly mixed and then returned to 50°C for 1 h. Following assembly, all DNAs were precipitated in 0.5 M ammonium acetate and 70% ethanol. Pelleted DNA was washed with 70% ethanol and stored at -20°C prior to electroporation.
For analysis of assembly efficiency, 8.8 μg of pooled plasmid DNA from each of the seven blocks was digested with BstBI. After 30 min at 50°C, one half of the digest was transferred to a second tube and combined with the enzyme components required for assembly. Both tubes were incubated at 50°C for an additional 60 min and then put on ice. An equal proportion of each mixture was analyzed on a 0.8% agarose gel run at 40 V for 11 h. Mono cut bacteriophage lambda DNA and 1 kb-plus ladder (New England Biolabs) were run as size markers.
For analysis of assembly efficiency, 8.8 μg of pooled plasmid DNA from each of the seven blocks was digested with BstBI. After 30 min at 50°C, one half of the digest was transferred to a second tube and combined with the enzyme components required for assembly. Both tubes were incubated at 50°C for an additional 60 min and then put on ice. An equal proportion of each mixture was analyzed on a 0.8% agarose gel run at 40 V for 11 h. Mono cut bacteriophage lambda DNA and 1 kb-plus ladder (New England Biolabs) were run as size markers.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!