The largest database of trusted experimental protocols

Dulbecco s modified eagle s

Manufactured by Thermo Fisher Scientific
Sourced in United States

Dulbecco's modified Eagle's medium (DMEM) is a cell culture media formulation widely used for the growth of various mammalian cell lines. It provides the necessary nutrients, amino acids, vitamins, and other components to support cell growth and maintenance in vitro.

Automatically generated - may contain errors

26 protocols using dulbecco s modified eagle s

1

Culturing Gingival Fibroblasts in Growth Medium

Check if the same lab product or an alternative is used in the 5 most similar protocols
We cultured the gingival fibroblast cell lines in a t25 culture flask using a mixed medium of DMEM (Dulbecco’s Modified Eagles, Gibco, Waltham, MA, USA), 10% (v/v) fetal bovine serum (Invitrogen, Waltham, MA, USA.), Antibiotic-Antimycotic™ (Amphotericin B, Penicillin, Streptomycin) 1%, and GlutaMAX™ 1% (Invitrogen, Waltham, MA, USA). We then incubated this in an incubator (Shel Lab, Sheldon, Cornelius, OR, USA) that controls volume, with the following parameters: carbon dioxide 5%, temperature 37 °C, humidity 95%. We changed the cell culture every 2–3 days until the cells grew to 90% confluence.
+ Open protocol
+ Expand
2

Culturing Mouse and Human Lymphoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Eμ-Myc mouse lymphoma cells were cultured in high-glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco), 50 μM β-mercaptoethanol (Sigma-Aldrich), 100 μM asparagine (Sigma-Aldrich), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco) at 37°C and 10% CO2. OP9 cells were cultured in αMEM (Gibco) supplemented with 20% heat-inactivated FBS, 1 mM glutamine (Gibco), 10 mM Hepes (Gibco), 1 mM sodium pyruvate (Gibco), 50 μM β-mercaptoethanol, 100 U/mL penicillin, and 100 μg/mL streptomycin. Human cell lines were cultured in a humidified incubator at 37°C and 5% CO2. Virus-producing 293T cells were maintained in DMEM supplemented with 10% FBS. Approximately 6 h prior to transfection, 293T cells were cultured in DME glutamax (Gibco) supplemented with 10% FBS and 25 mM Hepes. Rael-BL, Ramos-BL, Sav-BL, and BL-31 human Burkitt lymphoma-derived cell lines were cultured in RPMI 1640 supplemented with 10% FBS, 1 mM glutamine (Gibco), 1 mM sodium pyruvate (Gibco), 50 μM α-thioglycerol (Sigma-Aldrich), and 20 nM bathocuproine disulfonic acid (BCS) (Sigma-Aldrich). X50-7 and Awia lymphoblastoid cell lines were cultured in RPMI 1640 supplemented with 10% FBS and 1 mM glutamine.
+ Open protocol
+ Expand
3

BALB/cByJNarl Mice for Lung Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the purpose of this research, six-week-old male BALB/cByJNarl mice were purchased from the National Laboratory Animal Breeding and Research Center (Taipei, Taiwan). Each cage housed two mice, and sterilized food and water were provided. The mice were kept at a constant temperature (22 ± 2 °C) and relative humidity (55 ± 5%) under a 12:12 h light:dark cycle. The animal use protocol was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) at the National Chiayi University (IACUC Approval No. 108028). All procedures were in line with the Guidelines for the Care and Use of Laboratory Animals by Taiwan’s Ministry of Health and Welfare.
The A549 human lung carcinoma cell line was purchased from the Bioresource Collection and Research Center (Hsinchu, Taiwan). The cells were grown in Dulbecco’s modified Eagle’s medium and supplemented with 5% fetal bovine serum, 50 IU/mL of penicillin, and 50 mg/mL of streptomycin (Gibco Laboratories, Grand Island, NY, USA) in a humidified atmosphere of 95% air and 5% CO2 at 37 °C. The cells were routinely passaged by removing the medium and overlaying the cell monolayer with 0.25% trypsin and 0.1% EDTA.
+ Open protocol
+ Expand
4

Transient transfection of ORF7b in HEK293T and Vero E6 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells and Vero E6 cells were cultured in the Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (Gibco, Billings, MT, United States) in an atmosphere of 5% CO2 at 37°C. Cells were divided into 12 wells overnight before transient transfection. The plasmid (500 ng) encoding flag-ORF7b was transfected into cells for 18 h using Lipofectamine 3000 according to the manufacturer’s (Thermo Scientific, Waltham, MA, United States) instructions.
+ Open protocol
+ Expand
5

Knockdown of LAMP-2A in Colorectal Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
NCM460, HCT116, Caco-2, and SW480 cells were purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in Dulbecco’s modified Eagle’s (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Biological Industries, Beit Haemek, Israel) at 37 °C under 5% (volume/volume) CO2 atmosphere. LAMP-2A siRNA was transfected into cells by Lipofectamine RNAi max (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) for 72 h. The siRNA sequences are as follows: LAMP-2A siRNA: GGCAGGAGUACUUAUUCUAGU; nontargeting siRNA: AATTCTCCGAACGTGTCACGT.
+ Open protocol
+ Expand
6

Virus Propagation and LAMP Specificity

Check if the same lab product or an alternative is used in the 5 most similar protocols
Vero cells and MDCK cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Carlsbad, CA, USA) supplemented with 10% inactivated foetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA), 2 mM l-glutamine (Gibco) and 100 U/mL penicillin/streptomycin (Gibco) at 37 °C in 5% CO2. Influenza A virus (A/chicken/Pakistan/UDL-01/2008(H9N2), Newcastle disease virus strain LaSota and infectious bronchitis virus strain H120, Vesicular stomatitis virus (VSV) and Sendai virus (SeV) were propagated and used to determine the specificity of the LAMP. All viruses except influenza were titrated on Vero and MDCK cells, respectively, by the standard plaque assay.
+ Open protocol
+ Expand
7

Plin5-knockdown Hepatocyte Development and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
SK-HEP1, a human liver cancer cell line, was obtained from ATCC and cultured in Media consisting of Dulbecco's modified Eagle's (Gibco) with 10% fetal bovine serum (Gibco) and 50 g/ml penicillin/streptomycin. We constructed Plin5-knockdown hepatocytes by transducing the Plin5 gene with small interfering RNA (siRNA). The siRNA target sequences were as follows: non-targeting control siRNA: sense, 5ʹUUCUCCGAACGUGUCACGUTT-3; antisense, 5ʹACGUGACACGUUCGGAGAATT-3ʹ. hPlin5 siRNA: sense, 5ʹCUGUGGAUGUUGUACUGGATT; antisense, 5ʹUCCAGUACAACAUCCACAGTT-3ʹ. All siRNAs were validated by Western blotting to demonstrate a target knockdown of > 80%. Cell transfection was carried out using GP-transfect-Mate per the manufacturer’s instructions (GenePharma).
+ Open protocol
+ Expand
8

Culturing Human Hepatocellular Carcinoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human HCC SMMC-7721 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Invitrogen, USA), 100 IU/ml penicillin and streptomycin (Gibco, USA).
+ Open protocol
+ Expand
9

Culturing MDCK Cells for Influenza Virus Propagation

Check if the same lab product or an alternative is used in the 5 most similar protocols
MDCK cells (Sigma) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco), 2 mM glutamine, and penicillin (100 U/mL) and streptomycin (100 μg/mL) (penicillin-streptomycin-glutamine [100×]; Gibco) in 5% CO2 at 37°C. Experiments were carried out on the A/California/04/2009 (H1N1) (a gift from Prof. Luis Martinez-Sobrido, University of Rochester) and A/PR/8/34 (H1N1) influenza strains propagated in MDCK cells. The virus titer was determined by a standard plaque assay.14 (link)
+ Open protocol
+ Expand
10

Mucopolysaccharidosis fibroblast cell culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fibroblasts derived from patients suffering from MPS IVA and IVB, and the control fibroblast line (HDFa) was purchased from the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research (Camden, NJ, USA). MPS cells bear the following mutations: MPS IVA, p.Arg386Cys/p.Phe285Ter (in the GALNS gene), and MPS IVB, p.Trp273Leu/p.Trp509Cys (in the GLB1 gene). Cells were cultured in the DMEM medium (Dulbecco’s modified Eagle’s, Gibco Ltd., London, UK), supplemented with 10% (v/v) FBS (fetal bovine serum) and standard penicillin-streptomycin mixture, at 37 °C, 95% humidity, 5% CO2 saturation.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!