A Trizol reagent was used to extract RNA from AGE1.HN cells following SCI induction and spinal cord tissue samples (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). RNA was reverse transcribed into cDNA using the First Strand cDNA Synthesis kit (GeneCopoeia, Inc., Rockville, MD, USA). qPCR was performed using the ABI 7300HT real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the SYBR green supermix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) The thermocycling conditions were as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 30 sec, 58°C for 45 sec and 72°C for 30 sec. Relative gene expression was assessed using the 2−∆∆Cq method (17 (link)).
First strand cdna synthesis kit
Manufactured by GeneCopoeia
Sourced in United States, China
The First-Strand cDNA Synthesis Kit is a laboratory tool used to generate complementary DNA (cDNA) from RNA samples. It provides the necessary enzymes, buffers, and reagents to efficiently reverse-transcribe RNA into single-stranded cDNA for subsequent analysis or applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Dnase 1, by GeneCopoeia (2 mentions)
7900ht system, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Abi 7300ht real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green supermix, by Bio-Rad (1 mentions)
Mirna qrt pcr detection kit, by GeneCopoeia (1 mentions)
Trizol reagent, by CoWin Biotech (1 mentions)
Primescript rt reagent kit, by GeneCopoeia (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
Tripure isolation reagent, by Roche (1 mentions)
Total rna kit 1, by Omega Bio-Tek (1 mentions)
Trizol reagent, by GeneCopoeia (1 mentions)
Quantstudio 5, by Thermo Fisher Scientific (1 mentions)
Rna extraction kit, by Omega Bio-Tek (1 mentions)
Rna rapid extraction kit, by Takara Bio (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
24 protocols using first strand cdna synthesis kit
1
RNA Extraction and qPCR Analysis of SCI Samples
2
Quantifying miR-101 and VEGF-C Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Isolated RNA was measured using a Nanodrop 1000 spectrophotometer (Thermo Scientific, DE, USA) with an OD260/OD280 ratio greater than 1.8 used for cDNA synthesis. The reverse transcription of miR-101 and its specific amplification were performed using a miRNA qRT-PCR Detection Kit (GeneCopoeia, MD, USA). U6 was used as an endogenous control. cDNA synthesis of VEGF-C was performed using a First-Strand cDNA Synthesis Kit (GeneCopoeia, MD, USA), and the real-time quantitative PCR (RT-qPCR) reaction of VEGF-C was performed using qPCR Mix (GeneCopoeia, MD, USA). GAPDH was used for VEGF-C template normalization. All primers were purchased from GeneCopeia. miR-101 and VEGF-C amplification were determined on a ROTOR-GENE 3000 platform. The target PCR threshold cycle (Ct) values were normalized by subtracting the U6 or GADPH Ct value, which provided the ΔCt value. Relative expression was calculated using the following equation: relative gene expression level = 2 -(ΔCt experimental group-ΔCt control group).
3
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol reagent (CW0580S, CoWin Biosciences, Beijing, China) was utilized to extract total RNA from the indicated cells following protocol. First-Strand cDNA Synthesis Kit (QP057, GeneCopoeia, MD, USA) was employed to reverse transcribe the two mRNA micrograms into cDNA. The following PCR primers were used in this experiment: KLF6 forward primer (5′-CTCTCAGCCTGGAAGCCTTTTAGCCTAC-3′) and reverse primer (5′-ACAGCTCCGAGGAACTTTCTCCCA-3′) and GAPDH forward primer (5′-TGACGTGGACATCCGCAAAG-3′) and reverse primer (5′-CTGGAAGGTGGACAGCGAGG-3′). The PCR procedure involved a primary step at 95°C for 5 min, from there on 35 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s were conducted. GAPDH was employed as a loading control. PCR products were 435 and 205 bp in length, respectively. Ethidium bromide-stained agarose gels were applied to separate the PCR bands with ImageJ 1.41° software (National Institute of Mental Health, USA) employed to determine band intensity.
4
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain RNA extracts, TRIzol reagent (Invitrogen) was used. The complementary DNA (cDNA) was produced from extracted RNAs utilizing PrimeScript RT reagent Kit and First-Strand cDNA Synthesis Kit (GeneCopoeia, Guangzhou, China) with the genomic DNA (gDNA) Eraser kit (Takara, Dalian, China). The PCR reactions were accomplished utilizing SYBR Premix Ex Taq II (Takara) on a StepOne Plus Real Time PCR System (Life Technologies). Small nuclear RNA U6 (for miRNA) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (for lncRNA and mRNA) were internal controls. Primers were as follows:
| LINC00461 | 5′-GACATTTACGCCACAACCCACG-3′ |
| 5′-AGACAGACCCTCAGATTCCCCA-3′ | |
| E2F1 | 5′-CCCATCCCAGGAGGTCACTT-3′ |
| 5′-CTGCAGGCTCACTGCTCTC-3′ | |
| MiR-4478 | 5′-AGGGCTAGGTGGAAAGACCT-3′ |
| 5′-CCTTCCTGATCGGGACATCG-3′ | |
| GAPDH | 5′-CCACATCGCTCAGACACCAT-3′ |
| 5′-TGACAAGCTTCCCGTTCTCA-3′ | |
| U6 | 5′-CTCGCTTCGGCAGCACA-3′ |
| 5′-AACGCTTCACGAATTTGCGT-3′ |
5
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from Raw 264.7 cells and the repaired tissues using TRIZol (Invitrogen, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. The RNA samples (1 μg/each) were reverse transcribed into cDNA using the First Strand cDNA Synthesis Kit (GeneCopoeia, USA) following the manufacturer’s instructions. The relative levels of the target gene mRNA transcripts in individual samples were determined by quantitative PCR using the Applied Biosystems 7700 Real-time PCR system (Thermo Fisher Scientific, Inc., USA), the SYBR Green Real-time PCR Master Mix (TOYOBO, Japan) and specific primers. The sequences of primers are listed in Table 1 . The PCR reactions were performed in duplicate at 95°C for 2 minutes and were subjected to 45 cycles of 95°C for 15 seconds, 58°C for 15 seconds, and 72°C for 45 seconds. The data were normalized to Gapdh and were calculated by the 2−ΔΔCt method.
6
RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR analysis was conducted as described previously [31 (link)]. Briefly, TRIzol reagent was used to extract total RNA in accordance with the manufacturer’s instructions. The cDNA was obtained by reverse transcription using First-Strand Cdna Synthesis Kit (Genecopoeia, Guangzhou, China), after which PCR was performed on a real-time RT-PCR machine (ABI 7500, USA). GADPH was used as an internal control. The sequences of the primers used for the experiment were shown in the Supplementary Materials Table S1 . A single DNA duplex was generated by melting curve analyses, and the 2−ΔΔCt method was used to perform quantitative measurements.
7
RNA Extraction and Quantification from Rat Intervertebral Discs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the rats were sacrificed, the T12/L1 and L1/2 intervertebral discs were immediately immersed in RNAstore reagent and frozen in liquid nitrogen. Total RNA was extracted using TriPure Isolation Reagent (Roche Diagnostics, Indianapolis, IN, USA), and the concentration and purity were measured.RNA (1 μg) was reverse-transcribed using a First-Strand cDNA Synthesis kit (GeneCopoeia, Guangzhou, China). The transcripts of interest and of the housekeeping gene β-actin were amplified from first-strand cDNA by real-time PCR.
8
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the cells was extracted and reverse transcribed into cDNA according to the protocols of the Total RNA kit I (Omega Bio-Tek, Inc., Norcross, GA, USA) and First Strand cDNA Synthesis kit (GeneCopoeia, Inc.). The cDNA template (100 ng) was amplified using 0.2 µM primers and the 20 µl SYBR-Green-based qPCR reaction system (GeneCopoeia, Inc.). A Bio-Rad IQ 5 instrument (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used to perform the reaction and detect the fluorescent signals. Standard curves were created to confirm the amplification efficiency of each gene, while melting curves ensured the specificity of the amplification. Normalization to the reference gene (β-actin) was performed for each sample. Fold changes between the mRNA level of the ZEB1-KD groups and the scrambled control group were calculated according to the 2−ΔΔCq method (21 (link)). The sequences of primers were as follows (5′-3′): USP17 forward, AGGTGAGTGGCAGTTCAACC and reverse, GGAAGCTTCTTCCTGGGAGC; CHD1L forward, ACTAGCATTCCTGTATTCTGGGG and reverse, CACGCTCATAGCTGTAGCCTC; DUX4 forward, CGATGGCCCTCCCGACA and reverse, GGCGTGACCTCTCATTCTGA; and β-actin forward, CCTAGAAGCATTTGCGGTGG and reverse, GAGCTACGAGCTGCCTGACG.
9
Quantifying TSPO mRNA Expression in ARPE-19 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two mL of the growth medium containing cells (2 × 105 /mL) were plated in 6-well plates under the conditions mentioned above. The pre-treatments with carotenoids and UVB exposure were the same with the cell viability assay. After the treated cells incubated in the FBS free-medium for 24 h, total RNA of ARPE-19 was extracted using Trizol reagent (GeneCopoeia, Rockville, MD, USA) according to the manufactory’s instructions [26 (link)]. cDNA was synthesized using a first-strand cDNA synthesis kit (GeneCopoeia, Rockville, MD, USA). The primer sequences were listed in Table 1 . All samples were run in triplicates and the threshold cycle value (CT) was used to calculate the expression of mRNA. For each sample, ΔCT sample value was calculated by analyzing the difference between CT value of the target Homo TSPO gene and that of the Homo GAPDH reference gene. The relative expression levels were estimated by calculating the ΔΔCT (ΔCT sample-ΔCT reference) and using the 2-ΔΔCT method [28 (link)].
10
TXNRD1 Knockdown Efficiency Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to assess the knockdown efficiency of TXNRD1, total RNA was extracted from PASMCs using RNA Extraction Kit (#6834, OMEGA biotek) according to the manufacturer’s instructions. First-strand cDNA was reverse transcribed from total RNA using the First-Strand cDNA Synthesis Kit (GeneCopeia). mRNA level of TXNRD1 was quantified by Real-time PCR using SYBR Green qPCR Mix Kit (GeneCopeia) on QuantStudio 5 (Thermo) with following primer: 5′-GGTGAAAGGCCGCGCTA-3′ (forward), 5′ATAGGACGCGCCAACCACTA-3′ (reverse). Data were analyzed using the 2-ΔΔCT method with GAPDH as an internal control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!