The expression levels of the genes identified in the Dap-seq experiment were further analyzed using quantitative real-time PCR (qRT-PCR). Total RNA was extracted from M5-90 or M5-90 irr mutant cells with TRIzol (CWBIO, Beijing, China). Each group has three replicates. Briefly, the RNA concentration and quality were evaluated using a Nanodrop 2000 spectrophotometer (Thermo Fisher, USA). The extracted RNA was reverse-transcribed to cDNA using a First Strand cDNA Synthesis Kit (Beyotime, Shanghai, China) according to the manufacturer’s protocol. qRT-PCR was performed using SYBR (CWBIO, Beijing, China) and a ThermoFisher QuantStudio 3 RT PCR-Well Q3 (Thermo Fisher, USA). The primers for the target genes are listed in S1 Table . The reaction conditions used are as follows: initial denaturation at 95°C for 5 min followed by 46 cycles of 95°C for 30 s and annealing at 56°C or 60°C for 30 s. The data were normalized according to the expression level of the 16S ribosomal RNA and the expression level of each gene was calculated using the 2-ΔΔCT method.
First strand cdna synthesis kit
Manufactured by Beyotime
Sourced in China
The First Strand cDNA Synthesis Kit is a laboratory tool used to produce complementary DNA (cDNA) from messenger RNA (mRNA) templates. The kit provides the necessary reagents and protocols to efficiently convert mRNA into single-stranded cDNA for various downstream applications, such as gene expression analysis and next-generation sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Rt qpcr kit, by Vazyme (4 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Thermofisher quantstudio 3 rt pcr well q3, by Thermo Fisher Scientific (1 mentions)
Trizol, by CWBIO (1 mentions)
Sybr green premix ex taq, by Takara Bio (1 mentions)
Rna isolation kit, by Beyotime (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Nanodrop lite spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Trizol, by Merck Group (1 mentions)
Real time quantitative pcr instrument cfx96, by Bio-Rad (1 mentions)
Cfx96 real time pcr system, by Bio-Rad (1 mentions)
Sodium deoxycholate, by Maclin Biochemical Technology (1 mentions)
β actin af5003, by Beyotime (1 mentions)
Rnaprep pure micro kit, by Tiangen Biotech (1 mentions)
Cfx connect system, by Bio-Rad (1 mentions)
Rna extraction kit, by Beyotime (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Abi 7500 pcr equipment, by Thermo Fisher Scientific (1 mentions)
21 protocols using first strand cdna synthesis kit
1
Quantitative Gene Expression Analysis
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RAW264.7 cells were collected and the total RNA was extracted using RNA Isolation Kit (Beyotime). First Strand cDNA Synthesis Kit (Beyotime) was utilized to generate cDNA. The amplification and detection of cDNA targets were performed using SYBR Green Premix Ex Taq (Takara) on a StepOne Plus Real-time PCR system (Applied Biosystems). GAPDH was used as the internal control. The relative difference was calculated using the 2^(-ΔΔCT) method and expressed as fold change.
3
RT-qPCR Analysis of EMT Markers in HCC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (T9424, Sigma-Aldrich, USA) was used for total RNA extraction of treated or transfected HCC cells and tissues. All RNA extracted was subsequently preserved in −80°C. A NanoDrop Lite spectrophotometer (ND-LITE, Thermo Fisher Scientific, Waltham, MA, USA) was used for concentration determination. CDNA was then synthesized via a first strand cDNA synthesis kit (D7178S, Beyotime, China), and RT-qPCR was conducted by RT-qPCR kit (D7277S, Beyotime, China) and operated in Touch real-time PCR system (CFX86, Bio-Rad, USA) under the conditions: 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 62°C. Relative expressions were calculated using the 2−ΔΔCT method, in which GAPDH was used as an internal reference.19 (link) Primer sequences are referred to in Table 3 .
Primers for RT-qPCR
| Gene | Primers (5ʹ->-3ʹ) |
|---|---|
| EZH2 | |
| Forward | GAAGTTTTAGATCAGGATGG |
| Reverse | TGTCTAGAGCTGTTTCTGTG |
| N-Cadherin | |
| Forward | GCTGGTATCTATGAAGTTCC |
| Reverse | TAGGTGTAAGCTCTCTATGG |
| Vimentin | |
| Forward | CTTAAAGGAACCAATGAGTC |
| Reverse | GAGAAGTTTCGTTGATAACC |
| E-Cadherin | |
| Forward | GATGATGTGAACACCTACAA |
| Reverse | GTAGCTATGATTAGGGCTGT |
| GAPDH | |
| Forward | TTTTTGGTTTTAGGGTTAGTTAGTA |
| Reverse | AAAACCTCCTATAATATCCCTCCTC |
4
Quantifying Gene Expression in Brain Ischemia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA in brain ischemic penumbra tissues collected 24 h after operation or neurons treated with OGD for 24 h was extracted by Trizol (16096020; Thermo Fisher Scientific, Inc), followed by reverse transcription using the First Strand cDNA Synthesis Kit (D7168L; Beyotime Biotechnology Co, Ltd). After that, RT-qPCR was performed according to the manuals of the RT-qPCR kit (Q511-02; Vazyme Biotech). PCR amplification was performed with Bio-rad real-time quantitative PCR instrument CFX96. The relative expression level of Smurf2, YY1, HIF1α, and DDIT4 was standardized by β-actin expression. These values were then exponentiated to the power of 2 (2−ΔΔCt) to yield fold expression relative to the reference point. The primers are depicted in Table S1 .
5
TRIzol-based RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA from tissues or cells utilizing the TRIzol reagent (16096020, Thermo Fisher Scientific Inc., Waltham, MA), which was then reversely transcribed into cDNA using First Strand cDNA Synthesis kit (D7168L, Shanghai Beyotime Biotechnology, Shanghai, China). RT-qPCR was conducted using the RT-qPCR kit (Q511-02, NanJing Vazyme Biotech, Nanjing, China) on the Bio-Rad CFX96 Real-time PCR system (Bio-Rad Laboratories, Hercules, CA). With β-actin serving as internal control, the fold changes were calculated by the 2−△△Ct method. The primer sequences (shown in Supplemental Table 2 ) were provided by Sangon.
6
Quantitative RT-PCR analysis of PDCD4 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and was converted to cDNA using a First Strand cDNA Synthesis Kit (Beyotime Institute of Biotechnology), according to the manufacturer's instructions. Amplification of the cDNA was performed using the SYBR Green One-Step RT-qPCR Kit (Beyotime Institute of Biotechnology). The following thermocycling conditions were used for qPCR: 95˚C for 10 min, followed by 40 cycles of 95˚C for 10 sec and 60˚C for 60 sec. The primer sequences for qPCR are as follows: PDCD4 forward, 5'-GGACAGAAGAGGAACCACCG-3', reverse, 5'-AAAGAAAGGAGCGGCAGTCA-3'; and GAPDH forward, 5'-CAGGTTGTCTCCTGCGACTT-3' and reverse, 5'-CCCTAGGCCCCTCCTGTTAT-3'. GAPDH was used as an internal reference and the 2-ΔΔCq method (22 (link)) was used to calculate relative gene expression.
7
Quantifying Glycolysis, TCA, and PPP Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Glycolysis-associated genes, including phosphofructokinase muscle (PFKM), phosphofructokinase liver (PFKL), enolase 2 (ENO2), lactate dehydrogenase B (LDHB); TCA-related genes, including pyruvate dehydrogenase phosphatase 1 (PDP1), PDP2, aconitate hydratase 1 (ACO1) and oxoglutarate dehydrogenase (OGDH); and PPP-related genes, including 6-phosphogluconolactonase (6PGL), ribulose-phosphate-3-epimerase (PRE), transketolase (TKT), transaldolase 1 (TALDO1), were determined through qRT-PCR. All the primers used in this study had been previously published in reference articles (20–22 (link)). First Strand cDNA Synthesis Kit (Beyotime, Beijing) was used according to the manifactirer’s instruction. Incubate at 42°C for 60 min to obtain cDNA. A SYBR Green Real-Time PCR Master Mix Kit (TransGen Biotech, Beijing) was used according to the manufacturer’s instructions. Initial denaturation at 95°C for 30 s, then followed by 45 cycles of 95°C for 5 s, 60°C for 60 s and 72°C for 30 s. The relative FCs of target genes expression were quantified with β-actin used as the endogenous reference genes and the 2−ΔΔCt formula.
8
Shrimp Hemocyte Transcriptome and Proteome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each experiment, 50–100 k events from phagocytic hemocytes (R1) and control hemocytes (R2) were collected. Total RNA from the collected samples was purified using the RNAprep Pure Micro Kit (TIANGEN, Beijing, China) and reverse-transcribed into cDNA using a First Strand cDNA Synthesis Kit (Beyotime, Shanghai, China). qPCR was performed as previously described (Luo et al., 2022 (link); Supplementary file 10 ), and the gene expression level was recorded as relative expression to EF-1α. This experiment was repeated five times. Total proteins from sorted hemocytes were precipitated by adding 1/100 volume of 2% sodium deoxycholate (Macklin, Shanghai, China) and 1/10 volume of 100% trichloroacetic acid (Macklin), followed by vortexing and centrifugation at 15,000×g for 15 min at 4 °C. The pellet was collected for performing SDS-PAGE and immunoblotting, as described before (Luo et al., 2022 (link)). This experiment was repeated thrice. The following antibodies were used: β-actin (AF5003; Beyotime, Shanghai, China), anti-NAGA (13686-T24; SinoBiological, Beijing, China), and anti-LYZ1 (bs-0816R; Bioss Antibodies, MA, USA). The polypeptide antibody against shrimp NLRP3 (aa29-42) was prepared by GenScript (Nanjing, China).
9
Femoral Metaphysis RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the instructions, total RNA was prepared using TRIzol reagent (TAKARA BIO INC., Beijing, China). Briefly, 100 mg of femoral metaphysis tissue or cells from each well of six-well plates were homogenized in 1 mL of TRIzol reagent. After 5 min stain at RT and centrifugation, the RNA was extracted with chloroform and precipitated with isopropyl alcohol. RNA samples were then re-suspended in 50 μL of DEPC-treated H2O; 5 μg of total RNA was used in the first-strand cDNA Synthesis Kit (Beyotime). GAPDH was used as an internal control. The quantitative RT-PCR primers are listed in Table 2 . The PCR mixture (10 μL final volume per reaction) was prepared in accordance with the manufacturer’s protocol. Amplifications were performed under the following conditions: 95°C for 5 min, then 45 cycles at 95°C for 5 s, 59°C for 15 s, 72°C for 20 s, and 65°C for 5 min on a PCR System. All RT-PCR reactions were performed using the Bio-Rad CFX Connect system.
10
Quantification of P-selectin mRNA in PVT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR analyses were performed to detect the mRNA expression level of P-selectin, a biomarker of PVT (20 (link)) in rats of the model and control groups 24 h following surgery. Total RNA was extracted from blood samples using RNA Extraction kit and reverse transcribed into cDNA using the First Strand cDNA Synthesis kit (both Beyotime Institute of Biotechnology, Shanghai, China). The following thermocycling conditions were used for cDNA synthesis: 45°C for 60 min and 70°C for 10 min. qPCR was subsequently performed using the BeyoFast™ SYBR Green qPCR Mix (2X) kit (Beyotime Institute of Biotechnology) using the following specific primer pairs: P-selectin forward, 5′-GAGGCAGAGACCTCACAGCCAG-3′ and reverse, 5′-GTCAGGTAAGTGGCCAATG-3′; and β-actin forward, 5′-ACACCTTCTACAATGAGCTG-3′ and reverse, 5′-CTGCTTGCTGATCCCATCT-3′. The following thermocycling conditions were used for qPCR: Initial denaturation at 94°C for 3 min; 30 cycles at 94°C for 30 sec, 62°C for 30 sec and 72°C for 30 sec; and a final extension at 72°C for 5 min. The relative P-selectin mRNA levels were quantified using the 2−ΔΔCq method (21 (link)) and normalized to the internal reference gene β-actin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!