Thermo nanodrop 2000

Total RNA was isolated from hybridoma cells secreting monoclonal antibody (mAb) against hPCSK9 by RNAiso reagent and quantified by measuring A₂₆₀ nm on a Thermo NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). Then the first-strand cDNA was amplified by reverse transcription-polymerase chain reaction (RT-PCR) using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China), and the variable region genes of the heavy and light chains of selected mAb were respectively amplified by PCR using PrimeSTAR^® HS DNA Polymerase (TaKaRa, Dalian, Liaoning, China) and previously published primer pairs [35 (link)] with minor modification (Table S1).

DNA was extracted from 500 μL of frozen blood using a whole blood genomic DNA extraction kit (Tianjin Xiupeng Biotechnology Development Co., Ltd., Xiqing District, Tianjin, China) according to the instructions. DNA concentration and purity were detected by an ultramicro UV spectrophotometer (Thermo NanoDrop 2000, Thermo Scientific, Wilmington, DE), and samples with a concentration of 12.5 to 100 ng/μL and an A260/A280 ratio between 1.6 and 1.9 were used for PCR analysis.

In this study, fecal sample collection and preservation operations were carried out by the standardized fecal procedure proposed by the International Human Microbiome Standard (IHMS) and the Human Microbiome Project (HMP) (https://www.hmpdacc.org).
According to the instructions, the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany) was used to extract DNA from the fecal samples in a Class II biosafety laboratory. After extraction, the DNA concentration was quantified using the UV microspectrophotometer Thermo Nano-Drop 2000 (Thermo Scientific, MA, USA). The total DNA was checked for quality by 1% agarose gel electrophoresis. Finally, after assessing the DNA integrity and fragment size, the qualified DNA extracts were suspended in H₂O and stored at −80°C prior to subsequent analysis.

cADMSCs were extracted using a DNA Isolation Kit (Tiangen, China) according to the manufacturer’s instructions. The ratio of telomere repeat copy number to single gene copy number (T/S) was determined using QRT-PCR in the CFX96 Real-Time PCR system. QRT-PCR procedures were described as follows: pre-denaturation at 94 °C for 10 min, followed by 39 cycles for 15 s at 94 °C, and annealing for 1 min at 56 °C. The telomere reaction mixture consisted of 1× Quantitect Sybr Green Master Mix, 2.5 mM of DTT, 100 nM of Tel-F primer (CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT), and 900 nM of Tel-R primer (GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT). 36B4 was used as the loading control, with 36B4-F primer (ACTGGTCTAGGACCCGAGAAG) and 36B4-R primer (TCAATGGTGCCTCTGGAGATT). DNA quantitation was performed using Thermo NanoDrop 2000 (Thermo Scientific) and double dilution of DNA in the control sample. Comparative CT values from QRT-PCR were used to draw the standard curve. The T/S ratio for each sample was calculated by dividing of the average 36B4 ngDNA value by the average telomere ngDNA.

PCR products were detected by 2% agarose gels and purified by AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA). After that, Thermo NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA) and 2% agarose gel electrophoresis were used for library quality control. A specific 16S primer was designed to amplify the specific region, and about 425 bp amplified fragment was obtained. The paired-end data of PE250 were obtained by sequencing using the Illumina platform, and a longer sequence was obtained by splicing, which was used for 16S analysis. OTUs (Operational taxonomical Units) were clustered with 97% similarity cutoff using Usearch (version 7.0.1090 http://drive5.com/usearch/, accessed on 15 October 2021); each out represents one species. In order to avoid the analysis bias caused by the different sample sequence data size, if the sequence depth was enough, according to the minimum sequence number matching to the OTUs, random drawing was carried out, and Alpha diversity was analyzed. A representative sequence of the read was extracted from each OTU, which was compared with RDP Classifier (http://rdp.cme.msu.edu/, accessed on 15 October 2021); the species of each OTU was classified, and the species abundance table was obtained for follow-up analysis.

Total RNA was extracted from HepG2 and AML12 cells and liver tissues by using RNAiso Plus reagent according to the manufacturer’s instructions and quantified by measuring A260nm using Thermo NanoDrop 2000 (Thermo Fisher Scientific). For mRNA quantification, cDNA was generated using the BeyoRT II First Strand cDNA Synthesis Kit with gDNA Eraser. The qRT-PCR analyses were performed using BeyoFast SYBR Green qPCR Mix on a MX3000PTM qRT-PCR instrument (Agilent Technologies, Santa Clara, CA). To measure mRNA expression levels, the data were normalized to the housekeeping gene β-actin or GAPDH. Primers for each gene are listed in Table S5. The 2^−ΔΔCt method⁵¹ (link) was used to calculate relative gene expression levels.