The oligos (60 bp, containing Slco1b2 knock out target-site) and all primers for PCR/Q-PCR were synthesized by Biosune Biotechnology Co., Ltd. (Shanghai, China). KOD-plus-Neo polymerase was purchased from Toyobo (Osaka, Japan). SYBR Premix Ex Taq and Prime Script RT Reagent Kit were bought from Takara (Dalian, China). T7 endonuclease I (T7E I) was purchased from New England Biolabs (Ipswich, MA, USA). Phenol:chloroform:isoamyl alcohol (25:24:1, v/v/v) was purchased from Amresco (Cleveland, OH, USA). Bicinchoninic acid kit was purchased from Thermo Scientific (Waltham, MA, USA). The agarose gel recovery kit was bought from Generay Biotech Co., Ltd. (Shanghai, China). A primary antibody for OATP1B2 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was purchased from Abcam (Cambridge, UK). The fluorescence-conjugated secondary antibody to rabbit IgG and mouse IgG were bought from Cell Signaling Technology (Boston, MA, USA). Pitavastatin was obtained from MedChemExpress (Monmouth Junction, NJ, USA).
T7 endonuclease 1 t7ei
Manufactured by New England Biolabs
Sourced in United States
T7 Endonuclease I (T7EI) is a DNA-specific endonuclease enzyme isolated from the T7 bacteriophage. It recognizes and cleaves DNA at specific heteroduplex structures formed by non-perfectly matched or mismatched DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Nebuffer 2, by New England Biolabs (2 mentions)
Glyceraldehyde 3 phosphate dehydrogenase gapdh, by Abcam (1 mentions)
Kod plus neo polymerase, by Toyobo (1 mentions)
Bicinchoninic acid kit, by Thermo Fisher Scientific (1 mentions)
Phenol chloroform isoamyl alcohol, by Avantor (1 mentions)
Fluorescence conjugated secondary antibody to rabbit igg and mouse igg, by Cell Signaling Technology (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Wizard sv gel and the pcr clean up system, by Promega (1 mentions)
D1000 screentape, by Agilent Technologies (1 mentions)
Tapestation 2200, by Agilent Technologies (1 mentions)
Universal genomic dna purification mini spin kit, by Beyotime (1 mentions)
Wizard sv genomic dna purification system, by Promega (1 mentions)
5 protocols using t7 endonuclease 1 t7ei
1
Knock Out of Slco1b2 Gene Expression
2
CRISPR-Cas9 Gene Editing Efficiency Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRISPR-sgRNA target site was amplified by a high-fidelity PCR reaction from genomic DNA and purified by Wizard SV Gel and the PCR Clean up System (Promega). The primer sequences for PCR are shown in Supplementary Table 5 . Purified PCR products (400 ng) were denatured (95 °C for 5 min) and re-annealed by gradually cooling from 95 °C to 85 °C at −2 °C/sec and 85 °C to 25 °C at −0.1 °C/sec in NEBuffer 2 (NEB) using a programmable thermocycler. The re-annealed PCR product was digested by 10 units of T7 endonuclease I (T7EI, NEB, Cat. No. M0302L) for 15 minutes at 37 °C. The reaction was stopped by the addition of 0.25 M EDTA solution, and the sample was placed on ice. The PCR products were analyzed on 2% agarose gel to quantify the intensity of the digested and undigested bands by ImageJ software or on High Sensitivity D1000 ScreenTape with TapeStation 2200 (Agilent Technologies). The percentage of nuclease-specific cleavage peak area in the summed band area (expressed as the fraction cleaved) was used to estimate the gene editing levels using the following equation35 (link), % mutation = 100 × (1 − (1 − f)1/2), where f is the fraction cleaved.
3
Quantifying Genomic DNA Editing Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA (gDNA) was isolated using the Universal Genomic DNA Purification Mini Spin Kit (Beyotime, D0063, Shanghai, China). The resultant gDNA was used as a template for PCR with primers surrounding the sgRNA-UL8 and sgRNA-UL29 target sites. The following two pair primers were used for PCR amplification, named UL8-PCR-F, UL8-PCR-R, UL29-PCR-F, and UL29-PCR-R. Next, the PCR product was incubated with T7 Endonuclease I (T7EI) (NEB, M0302S, Ipswich, MA, USA) according to the specification, and cleavage was visualized with an agarose gel (1.5%). DNA was then digested with 5–10 units of T7EI for 30–60 min at 37 °C and resolved in an agarose gel. Quantification of gene disruption was performed using ImageJ software (NIH49) and calculated using Eqs. (1) and (2) :
These PCR products were also sequenced by Sanger sequencing and analyzed by Tracking of Indels by Decomposition (TIDE) (https://tide.nki.nl/ ).
These PCR products were also sequenced by Sanger sequencing and analyzed by Tracking of Indels by Decomposition (TIDE) (
4
CRISPR-Cas9 Gene Modification Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells (4 × 104 cells/well) were seeded into a 96-well plate the day before transfection. The pX330A-1 × 2 and pCAG-EGxxFP-PDGFRA vectors were transfected according to the method described above. After 48 h, genomic DNA was extracted using a Wizard SV Genomic DNA Purification System (Promega). The DNA fragment around the target site was amplified using the primers listed in Table S2 . PCR products were denatured in NEBuffer 2 (NEB) at 95 °C for 5 min and annealed at a ramp rate of −2 °C/s (95–85 °C) or −0.1 °C/s (85–25 °C). Annealed PCR products were incubated with T7 Endonuclease I (T7EI; NEB) at 37 °C for 15 min and analyzed by electrophoresis using 2% agarose gel. The densitometry analysis was performed using CS Analyzer 3.0 (ATTO, Tokyo, Japan). Gene modification was calculated using the formula: % gene modification = 100 × [1 − (1 − fraction cleaved)1/2].
5
CRISPR/Cas9 Editing of EBNA1 in EBV-Infected Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9‐mediated gene editing was undertaken according to a previous report.10 The gRNA targeting EBNA1 was cloned into a Lenti‐CRISPRv2 vector. To generate EBNA1‐edited cells, EBV‐infected cells were transduced with prepared lentivirus containing the constructed gRNA plasmid. For control cells, a lentivirus containing the Lenti‐CRISPRv2 empty vector was used. These cells were screened in selective media with 1 μg/mL puromycin. After screening for approximately 1 week, clones of resistant cells were isolated, and the effect of gene editing was examined with a T7 Endonuclease I (T7EI; NEB, Beverly, MA, USA) assay as previously described.11 The gRNA sequences were listed as follows: gRNA #1, 5′‐CACCGGTGTGAATCATGTCTGACGA‐3′; and gRNA #2, 5′‐CACCGGGCCCTGATCCTGAGCCGCC‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!