Sybr green pcr master
SYBR Green PCR Master is a ready-to-use solution for quantitative real-time PCR (qPCR) applications. It contains all the necessary components, including SYBR Green I dye, for the detection and quantification of DNA sequences.
Lab products found in correlation
7 protocols using sybr green pcr master
Quantitative Analysis of Beclin-1 Expression
Quantifying mRNA expression via qRT-PCR
Quantitative RT-PCR for METTL14 Expression
METTL14-F: GTCTTAGTCTTCCCAGGATTGTTT
METTL14-R: AATTGATGAGATTGCAGCACC
GAPDH-F: AGCCACATCGCTCAGACAC
GAPDH-R: GCCCAATACGACCAAATCC
Quantitative Analysis of mRNA and miRNA Levels
qRT-PCR Analysis of Gene Expression
Real-Time qPCR Analysis of Pluripotency Markers
Quantitative RT-PCR Analysis of mRNA and miRNA
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!