CircRNA was constructed according to our previous study (26 (link)). Briefly, the DNA sequences of circRNA containing the T7 promoter were amplified with a forward primer containing the T7 promoter and another specific primer. The purified PCR products were then used as the templates for in vitro transcription to obtain linear RNA by T7 RNA polymerase (TaKaRa). After that, the transcript was ligated with RNA ligase (NEB, Beijing, China), and the ligated product was treated with DNase I and RNase R to generate circRNA. The primer sequences for in vitro circularization of RNA are listed in Table 1 .
Rna ligase
Manufactured by New England Biolabs
Sourced in China
RNA ligase is a class of enzymes that catalyze the formation of phosphodiester bonds between the 5' phosphate and 3' hydroxyl groups of RNA molecules. This enzyme plays a crucial role in RNA processing and repair pathways.
Automatically generated - may contain errors
Lab products found in correlation
T7 rna polymerase, by Takara Bio (2 mentions)
Thermostable 5 appdna rna ligase, by New England Biolabs (2 mentions)
T4 rna ligase 1, by New England Biolabs (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Genepix 4000b scanner, by Molecular Devices (1 mentions)
Amv reverse transcriptase, by Roche (1 mentions)
Peg400, by Merck Group (1 mentions)
Rnasin, by Promega (1 mentions)
7 protocols using rna ligase
1
Constructing Circular RNA In Vitro
2
miRNA Profiling of Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRNA profiling of 67NR and 4T1.2 cell lines was conducted using Exiqon miRCURY LNA microarrays (Qiagen, Australia). Briefly, total cell RNA (2 μg) isolated using Trizol (ThermoFisher) was labelled with 1 µL of Cy3 or Cy5 (500 ng/μL) fluorescent dinucleotide (Dharmacon, UK) in a buffer containing 0.1 mM ATP, 50 nM HEPES (pH 7.8), 2.5 mM DTT, 20 mM MgCl2, 10 mg/mL BSA, and 10% DMSO with 20 units RNA ligase (New England Biolabs) for 2 h at 4 °C. RNA was precipitated with 0.3 M sodium acetate (pH 5.2), 20 µg glycogen and 75% ethanol, washed with 70% ethanol, mixed and co-hybridised to the array in duplicate dye-swapping reactions at 60 °C overnight. Following washing, slides were analysed with a GenePix 4000B Scanner (Molecular Devices, USA) and differential expression analysed in Limma [71 (link)], using tools for linear modelling and the empirical Bayes statistic calculations.
3
Constructing Circular RNA In Vitro
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CircRNA was constructed according to our previous study (26 (link)). Briefly, the DNA sequences of circRNA containing the T7 promoter were amplified with a forward primer containing the T7 promoter and another specific primer. The purified PCR products were then used as the templates for in vitro transcription to obtain linear RNA by T7 RNA polymerase (TaKaRa). After that, the transcript was ligated with RNA ligase (NEB, Beijing, China), and the ligated product was treated with DNase I and RNase R to generate circRNA. The primer sequences for in vitro circularization of RNA are listed in Table 1 .
4
FLAC Method for Full-Length cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length cDNAs were prepared using the FLAC method [27 (link)]. Briefly, an anchor primer (GACCTCTGAGGATTCTAAAC/iSp9/ TCCAGTTTAGAATCC-OH3′) was ligated to the 3′ ends of the dsRNA. Ligations were carried out in a volume of 20 µL containing 10 µL of total RNA extract, 1 µg (in 1 µL) of anchor primer and 10 units of RNA ligase (New England Bio Labs, Ipswich, MA, USA). The reaction was incubated at 10 °C overnight. Excess non-ligated anchor primer was removed by electrophoresis on 1% agarose gel in TAE buffer. The total dsRNA was recovered from the gel in a volume of 15 µL using RNaid kit, as previously described [24 (link)].
Prior to reverse transcription (RT), the dsRNA was heat denatured at 99 °C for 3 min. The RT reaction contained 11 µL of heat denatured dsRNA (1 µg), 2 µL of 10 mM dNTP mix and 4 µL of AMV RT buffer and 1 µL (21 units) of AMV reverse transcriptase (Roche). The reaction was incubated at 37 °C for 1 h, allowing the anchor primer to self-prime, generating a full-length cDNA copies of each dsRNA segment, which were used for PCR.
Full-length cDNAs were PCR amplified using KOD Hot Start DNA Polymerase as described by the manufacturer in presence of primer 5-15-1(5′-GAGGGATCCAGTTTAGAATCCTCAGAGGTC-3′).
Prior to reverse transcription (RT), the dsRNA was heat denatured at 99 °C for 3 min. The RT reaction contained 11 µL of heat denatured dsRNA (1 µg), 2 µL of 10 mM dNTP mix and 4 µL of AMV RT buffer and 1 µL (21 units) of AMV reverse transcriptase (Roche). The reaction was incubated at 37 °C for 1 h, allowing the anchor primer to self-prime, generating a full-length cDNA copies of each dsRNA segment, which were used for PCR.
Full-length cDNAs were PCR amplified using KOD Hot Start DNA Polymerase as described by the manufacturer in presence of primer 5-15-1(5′-GAGGGATCCAGTTTAGAATCCTCAGAGGTC-3′).
5
Single-Stranded DNA Adapter Ligation for PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 7
With reference to
Specifically, 20 μl of the RNase-treated beads can be added to a single PCR tube. 80 μl of ligase mix (5 μl T4 RNA ligase 1 (NEW ENGLAND BIOLABS®), 10 μl 10×T4 RNA ligase buffer, 5 μl BC_0047 oligo at 50 μM, 50 μl 50% PEG 8000, and 10 μl 10 mM ATP) can be added to the 20 μl of beads in the PCR tube. 50 μl of the ligase mixed with the beads can be transferred into a new PCR tube to prevent too many beads from settling to the bottom of a single tube and the sample can be incubated at 25° C. for 16 hours.
6
3' cDNA Adapter Ligation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 7
With reference to
Specifically, 20 μl of the RNase-treated beads can be added to a single PCR tube. 80 μl of ligase mix (5 μl T4 RNA ligase 1 (NEW ENGLAND BIOLABS®), 10 μl 10×T4 RNA ligase buffer, 5 μl BC_0047 oligo at 50 μM, 50 μl 50% PEG 8000, and 10 μl 10 mM ATP) can be added to the 20 μl of beads in the PCR tube. 50 μl of the ligase mixed with the beads can be transferred into a new PCR tube to prevent too many beads from settling to the bottom of a single tube and the sample can be incubated at 25° C. for 16 hours.
7
DNA Linker Ligation and Bead Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The supernatant was magnetically removed and the beads were resuspended in 20 μl of L3 DNA linker ligation mixture (8 μl water, 5 μl 4× ligation buffer, 1 μl RNA ligase [New England Biolabs], 0.5 μl RNasin [N2615, Promega GmbH], 1.5 μl pre-adenylated DNA linker L3-App [20 μM; 5′-/rApp/AGATCGGAAGAGCGGTTCAG/ddC/-3′], 4 μl PEG400 [202398, Sigma]). The mixture was incubated overnight at 16°C at 1,100 rpm in a thermomixer. Subsequently, 500 μl of PNK buffer was added. The beads were washed two times with 1 ml high-salt buffer and two times with 1 ml PNK buffer. After the first wash, the mixture was transferred to a new tube.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!