Pmd19 t vector system

Genomic DNA from different cells was bisulfite‐modified and purified with an EpiTect Bisulfite Kit (QIAGEN, Duesseldorf, Germany) according to the manufacturer's instructions. Bisulfite‐treated DNA was amplified with bisulfite‐sequencing PCR (BSP) primers targeted to the WTIP promoter. The primer sequences were TTAGTTGTTTTTAGTTTAGTTTG (forward) and AAAAAATATAAACTCCCAAA (reverse). PCR products were purified and cloned into the pMD19‐T Vector System (TaKaRa, Dalian, China). Three single colonies of each sample were selected for plasmid extraction and sequenced to determine the DNA methylation status.

Genomic DNA was extracted from the cells using the phenol-chloroform method. Bisulfite treatment was performed by the CpGenome Universal DNA Modification Kit (Millipore, USA) following the manufacturer’s instructions. PCR products for bisulfite sequencing were gel-purified and subcloned into a pMD19-T vector system (Takara, Dalian, China). At least ten colonies were sequenced to assess the degree of methylation at each CpG site. The primers are listed in S2 Table.

Genomic DNA was extracted from thyroids of 3 and 8-week-old mice in the control and Ev100 groups. EpiTect bisulfite kit (Qiagen, Valencia, CA) was used to deaminate cytosine to uracil according to the manufacturer’s instructions, while 5-methyl-cytosine was protected from deamination. Nested PCR was used to increase the specificity of DNA amplication (Primers are listed in Supplemental Table 1). Methylation status of the Pax8 CpG island was determined by cloning and sequencing of bisulfite-treated DNA. The purified PCR products were cloned using the pMD19-T vector system (TaKaRa, Dalian, China). The sequence obtained by cloning was analyzed with 3730 DNA Analyzer polymers (Applied Biosystems, Carlsbad, CA).

Genomic DNA was extracted from lymphocytes of umbilical cord blood in control and GDM groups. Bisulfite was converted using the EpiTect bisulfite kit (Qiagen, Valencia, CA) to deaminate cytosine to uracil according to the manufacturer’s instructions; 5-methyl-cytosine was protected from deamination. Analysis of the methylation status of the MCAT DMR was determined by cloning and sequencing of bisulfite-treated DNA. The purified PCR products were cloned using the pMD19-T vector system (TaKaRa, Dalian, China). The sequence obtained by cloning was analyzed with 3730 DNA Analyzer polymers (Applied Biosystems, Carlsbad, CA).

Genomic DNA was extracted from placenta of D18.5 mice in the control, F1-GDM, and GDM♂-GDM♀ groups. Bisulfite was converted using the EpiTect bisulfite kit (Qiagen, Valencia, CA) according to the manufacturer's instructions to deaminate cytosine to uracil; 5-methyl-cytosine was protected from deamination. The methylation status of Dlk1 differentially methylated region (DMR), Gtl2-DMR, and intergenic differentially methylated region (IG-DMR) was determined by cloning and sequencing of bisulfite-treated DNA. The full list of primer sequences is shown in Supplementary Table 2. The purified PCR products were cloned using the pMD 19-T vector system (Takara, Dalian, China). The cloned sequence was analyzed with 3730 DNA Analyzer Polymers (Applied Biosystems, Carlsbad, CA).

Genomic DNA was extracted from cells and tissue specimens using the phenol-chloroform method. Bisulfite treatment was performed using a CpGenome^TM Universal DNA Modification Kit (Millipore, USA), following the manufacturer’s instructions. Modified DNA was amplified, and PCR products were gel-purified and sub-cloned into a pMD19-T vector system (TAKARA, Japan). Ten colonies were sequenced to assess the degree of methylation at each CpG site. The PCR products of the tissue specimens were measured using Sequenom MassARRAY platform (Sequenom, Inc., San Diego, CA). The primers used are listed in Supplementary Table S1.

Genomic DNA was extracted via proteinase K digestion and phenol/chloroform extraction [25 (link)], denatured with NaOH and modified using sodium bisulfite and hydroquinone. Bisulfite-treated DNA was purified using a Wizard DNA clean-up system (Promega, Madison, WI, USA), following the manufacturer’s instructions. DNA was precipitated with ethanol after treatment with NaOH and eluted into 50 μl distilled water. The final products were stored at −80°C until use.
Bisulfite treatment was performed using an EpiTect Bisulfite Kit (Qiagen, Hilden, Germany) according to the manufacturer’s manual. Bisulfite-converted DNA was amplified using nested PCR. Primer sequences are shown in Additional file 1. Each 25 μl PCR reaction mixture contained 4 μl of bisulfite-treated DNA, and reactions were performed according to the method described by Kagamiet al. [26 (link),27 (link)]. The presence of amplified products was confirmed by electrophoresis on a 1.5% agarose gel.
PCR products were retrieved and ligated into the pMD19-T Vector System (TaKaRa). After transformation via heat shock into 200 μl competent Top10 cells (Tiangen, Beijing, China), colonies were isolated and cultured. For each sample, 15 positive clones were sequenced.