Primescripttmii cdna synthesis kit

Total RNA (1 μg) from E18.5 lungs of WT and Dip2b^tm1a/tm1a was subjected to cDNA synthesis in a 20 uL reaction using primescriptTMII cDNA synthesis kit (Takara, Dalian, China). All qPCRs were performed using Thermocycler (Analytik Jena AG, Jena, Germany) and SYBR II premix (Takara, Dalian, China). All results were normalized to housekeeping gene 18S ribosomal RNA and relative quantification was calculated using comparative threshold cycle (2^−ΔΔCt) values for three biological replicates.

One microgram of total RNA from brain and lung tissue of E19.5 WT and Dip2a^-/- embryos was reverse transcribed using primescriptTM^II cDNA synthesis kit (Takara, Dalian, China). QPCR was performed using Thermo cycler (Analytik Jena AG, Jena, Germany) and SYBR II premix (Takara, Dalian, China). All results were normalized to housekeeping gene 18S ribosomal RNA and relative quantification was calculated using comparative threshold cycle (2^-ΔΔCt) values for 3 biological replicates.

Total RNA from different tissues of 8-week-old male CBL57/6 mice was extracted using TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. Total RNA (1 μg) was reverse transcribed using a Primescript^TM II cDNA Synthesis Kit (Takara Biotechnology, Dalian, China). Quantitative real-time PCR was performed using a Light Cycler 480 sequence detection system (Roche, Indianapolis, IN, USA) and SYBR II premix (Takara). All results were normalized to 18S ribosomal RNA, and relative quantification was calculated using comparative threshold cycle (ΔΔCt) values for each biological replicate. Dip2b primers (mDip2b-QPCRF: TCTGGAGGTGCGAGAGATGA; mDip2b-QPCRR: TTGAGCGGTTGATCCAGGAC) and 18S primers (18S F: CGCCGCTAGAGGTGAAATTC; 18S R: CGAACCTCCGACTTTCGTTCT) were used for amplification.