Picrotoxin

Unless otherwise specified, all cell culture reagents were obtained from Invitrogen (Paisley, UK). Foetal bovine serum was from Biosera (Nuaille, France). Papain was obtained from Worthington Biochemical (Lakewood, NJ, USA). Caesium-gluconate, tetrodotoxin (TTX) and picrotoxin were from Hello Bio (Bristol, UK). Na₂GTP was from Scientific Laboratory Supplies (Newhouse, UK), whereas Na₂-creatine was from (Merck, London, UK). BMS-204352 was from Bio-Techne Ltd (Abingdon, UK). All other reagents were obtained from Sigma-Aldrich (Poole, UK) unless specified. Synaptophysin-pHluorin (sypHy) was provided by Prof. L. Lagnado (University of Sussex, UK). Rat dynamin-1aa fused to mCerulean at its C-terminus^{53 (link)} was subjected to site-directed mutagenesis to generate both R237W (forward primer ATTGGCGTGGTGAACTGGAGCCAGAAGGACATA, reverse primer TATGTCCTTCTGGCTCCAGTTCACCACGCCAAT) and K44A mutations (forward primer GGCCAGAGCGCCGGCGCGAGCTCGGTGCTGGAC, reverse primer CTCCAGCACCGAGCTCGCGCCGGCGCTCTGGCC). Base changes were confirmed by Source Bioscience Sanger Sequencing (Glasgow, UK).

Isolation of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) currents (Fig. 3) was accomplished using 50 µM D-AP5 (from 50 mM stock solution in water; Hello Bio) to inhibit N-methyl-D-aspartic acid receptors (NMDARs) and 50 µM picrotoxin (from 500 mM stock solution in DMSO; Abcam) to inhibit GABA_ARs while holding the neuron near its resting potential, at −78 mV. Isolation of NMDAR currents (Fig. 3) was accomplished by inhibiting AMPARs with 5 µM NBQX (from 50 mM stock solution in water; Hello Bio) and 50 µM picrotoxin while holding at +32 mV to relieve Mg²⁺ block of the NMDAR ion channel.
To test for neuromodulator effects on short-term depression (Fig. 2), antagonists were added to the bath and were continuously present during the experiments. To block metabotropic glutamate receptor (mGluR) activity, (S)-α-Methyl-4-carboxyphenylglycine (MCPG, dissolved in ACSF; Hello Bio) was used at a concentration of 0.5 or 1 mM. To block GABA_BRs, CGP-55845 (50 mM stock solution in DMSO; Tocris) was used at a concentration of 10 µM. To block CB₁Rs, AM-251 (10 mM stock solution in DMSO; Hello Bio) was used at 1 µM. To block A₁Rs, DPCPX (5 mM stock solution in DMSO; Hello Bio) was used at 1 µM.
For glutamate uncaging experiments, 2.5 mM MNI-glutamate (Tocris) was dissolved in ACSF and was continuously present in the bath solution.