Mxpro 4.01 qpcr software stratagene

Total RNA was isolated using Direct-zol™ RNA MiniPrep kit (ZYMO Research). All RNAs were treated with DNAse Max^TM kit (Quiagen), according to the manufacturer’s instructions. Using specific anti-sense primers for each target, 3 µg of ARN was reverse transcribed using SuperScript II reverse transcriptase kit (Invitrogen, Waltham, MA, USA), according to the manufacturer’s instructions. Complementary DNA (cDNA) was amplified by quantitative reverse-transcription PCR (qRT-PCR), using Takyon^TM No Rox SYBR^® MasterMix dTTP Blue (Eurogentec, Seraing, Belgium) and specific primers. qRT-PCR analyses were run on a Stratagene Mx3005P system (Agilent Technologies, Santa Clara, CA, USA) and analysed with MxPro 4.01 qPCR software Stratagene (Agilent Technologies, Santa Clara, CA, USA). Data was normalized using the Human elongation factor-1 α (EF-1α). Data analysis was performed using the 2^−∆CT method. Total TERRA was calculated as the sum of analysed TERRA from selected chromosomes. Sequences of all primers used are available in Supplementary Table S1 [56 (link),67 (link),75 (link)].

Telomere length was calculated by a standard quantitative qPCR assay as previously reported.30 The normalizing control gene used was Kallikrein Related Peptidase 3 (KLK3), located at 19q13.33. Fifty nanograms of target DNA was added to a reaction containing the pair of primers (telomere or KLK3) and Takyon^TM No Rox SYBR® MasterMix dTTP Blue (Eurogentec), in a total reaction volume of 25µl, according to the manufacturer's instructions. PCR experiments were carried out on a Stratagene Mx3005P system (Agilent Technologies) and analyzed with MxPro 4.01 QPCR software Stratagene (Agilent Technologies).
Primer sequences for both telomeres and KLK3 were as follows:
Telc 5'‐TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTATCCCTAACA‐3'.
Telg 5'‐ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT‐3'.24KLK3‐forward 5'‐AGGCTGGGGCAGCATTGAAC‐3'.
KLK3‐reverse 5'‐CACCTTCTGAGGGTGAACTTG‐3'.
Telomere (2 cycles of 95°C for 20 sec and 49°C for 20 sec, followed by 30 cycles of 95°C for 20 sec and 60°C for 20 sec, with signal acquisition) and KLK3 (40 cycles of 95°C for 20 sec and 60°C for 20 sec, with signal acquisition) reactions were run in separate 96‐well plates.
Data were collected from triplicate reactions for each sample (cell lines, patients, and healthy donors). Triplicate values were accepted when the standard deviation of Ct was below 0.5 among replicates. Results were calculated by the standard curve method.

In total, 1 µg of the total RNA was reverse transcribed using the SuperScript II reverse transcriptase kit (Invitrogen, Waltham, MA, USA), following the manufacturer’s instructions. The complementary DNA (cDNA) was amplified using specific primers (Supplementary Table S1) and Takyon^TM No Rox SYBR^® MasterMix dTTP Blue (Eurogentec, Seraing, Belgium). Amplifications were carried out on a Stratagene Mx3005P system and analyzed with MxPro 4.01 qPCR software Stratagene (Agilent Technologies, Santa Clara, CA, USA). The expression quantification was normalized to the expression level of the TATA box-binding protein (TBP) reference gene. The hTERT splicing variants were amplified as follows: initial denaturation step at 95 °C for 3 min, followed by 45 cycles of 95 °C for 20 sec and 60 °C for 60 s with signal acquisition. The 1301 cell line was used as a positive control and its dissociation curves were used as the reference (Supplementary Figure S1).