We analyzed the RNA expression differences of 22 genes in the Gene Expression Profiling Interactive Analysis (GEPIA) database. In addition, we collected 20 pairs of PC samples and adjacent normal samples in our hospital to analyze the RNA expression differences of these genes using RT-PCR, all of which were approved by the patient’s informed consent and the Ethics Committee of Zhejiang Provincial People’ Hospital. TRIzol (Thermo Fisher, United States) was used to extract the total RNA in the sample, and the reverse transcription kit, RR047A kit (Takara, Japan), was used to convert it into cDNA. Finally, the RR820A kit (Takara, Japan) was used to perform RT-PCR analysis on the 7900HT system (Thermo Fisher, United States), and the ACTB gene was used as the internal reference gene to calculate the expression of hub genes for each pair of tissues.
Rr820a kit
Manufactured by Takara Bio
Sourced in Japan
The RR820A kit is a laboratory equipment product manufactured by Takara Bio. It is a tool designed for specific research applications. The core function of this kit is to facilitate certain laboratory procedures, but no further details about its intended use can be provided in an unbiased and factual manner within the constraints of this request.
Automatically generated - may contain errors
8 protocols using rr820a kit
1
Comparative RNA Expression Analysis of PC
2
Quantitative Assessment of miR-338-3p and CHL1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was collected by RNAiso Plus (TAKARA 9108). Reverse transfection was performed according to the instructions (TAKARA 638313). The reaction conditions consisted of buffer/samples and enzyme at 37 °C for 60 min and 85 °C for 5 min, followed by adding 90 μl ddH2O to bring the total volume to 100 μl. RT-PCR was conducted by the instructions of TAKARA RR820A kit. U6 was chosen as internal controls. The primers of miR-338-3p were designed and synthesized by Takara Biomedical Technology (Shenyang, China). The sequences of primers were as follows:
| pre-mir-338: | AACAATATCCTGGTGCTGAGTG |
| miR-338-3p: | TCCAGCATCAGTGATT |
| CHL1: | Forward: CCTCCTGTTAAAATTCTCAA |
| Reverse: GGTTCTGGATTTCCTTTAG | |
| U6: | Forward: TGGAACGCTTCACGAATTTGCG |
| Reverse: GGAACGATACAGAGAAGATTAGC |
3
Isolation and Analysis of miR-149-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by RNAiso Plus (TAKARA 9108). Reverse transfection was conducted according to the TAKARA 638313 kit manufacturer's instructions. And then RT-PCR was performed using TAKARA RR820A kit. The sequence of miR-149-5p was as follows: Forward 5’-GTCTTCACTCCCGTGCTTGT-3’; Reverse 5’-CCCGAAACACCCGTAAGATA-3’.
4
RNA Extraction and qRT-PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell samples were processed directly with RNAiso Plus (Takara) according to manufacturer's protocol for RNA extraction. Extracted RNA was reversely transcribed to cDNA via using a RRO36A kit (Takara). The primers used were: YTHDC1: F‐TCAGGAGTTCGCCGAGATGTGT, R‐AGGATGGTGTGGAGGTTGTTCC; PTEN: F‐TGAGTTCCCTCAGCCGTTACCT, R‐GAGGTTTCCTCTGGTCCTGGTA; GAPDH: F‐GTCTCCTCTGACTTCAACAGCG, R‐ACCACCCTGTTGCTGTAGCCAA. A total of 10 ng cDNA was applied for quantitative real‐time polymerase chain reaction (PCR) with a RR820A kit (Takara). Cycle threshold values were determined and the correlated fold change was analysed.
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to phenotypic measurement, 10 samples with the highest and the lowest values of each trait were selected for quantitative analysis. Primer pairs were designed for six genes, AP2/ERF, TLP, PUP9, SLP, HSP, and OCT1. The cDNA was amplified according to the Takara rr820a kit (Takara, Shiga, Japan), and the expression levels of the genes were calculated using the 2-ΔΔCt method [39 (link)]. The UBI [40 (link)] gene was used to normalize the transcript profiles.
6
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Takara, Tokyo, Japan) and cDNA was synthesized using the RR047A kit (Takara, Tokyo, Japan) according to the manufacturer’s instructions. RT-qPCR was carried out in an Applied Biosystems QuantStudio 3 Real-Time PCR System (Waltham, MA, USA) with the RR820A kit (Takara, Tokyo, Japan). The primers were designed and synthesized in Sangon Biotech (Shanghai, China). The primers are listed in Table S2 . β-actin was used as the endogenous control, and the 2−ΔΔCT method was used to analyze the relative gene expression data.
7
Differential Expression Analysis of Prostate Cancer Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To visualize the differences in clinical expression of key gene proteins, we investigated the expression of these genes in PC tissue and normal tissue in the Human Protein Atlas (HPA) database. Furthermore, to verify the expression levels of 14 mRNAs, we performed differential gene expression analysis on tumor tissues and normal tissues in TCGA-PRAD. In addition, we collected 20 pairs of PC samples and adjacent normal samples in our hospital to analyze the RNA expression differences of these genes using rt-PCR, all of which were approved by the patients’ informed consent and the ethics committee of Zhejiang Provincial People’s Hospital. TRIzol (Thermo Fisher, USA) was used to extract the total RNA in the sample, and the “Reverse Transcription RR047A Kit (Takara, Japan) was used to convert it into cDNA. Finally, the RR820A kit (Takara, Japan) was used to perform rt-PCR analysis on the 7900HT system (Thermo Fisher, USA), and the ACTB gene was used as the internal reference gene to calculate the expression of hub genes with each pair of tissues.
8
RNA Isolation, Transfection, and RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by RNAiso Plus (TAKARA 9108). Reverse transfection was conducted according to the TAKARA 638313 kit manufacturer`s instructions. And then RT-PCR was performted using TAKARA RR820A kit.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!