The largest database of trusted experimental protocols

2 protocols using anti camkiv

1

Antibody and Primer Reagents for Flow Cytometry

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies for flow cytometry, anti-Kit-APC, anti-Mac-1-APC, anti-Gr-1-PE, anti-CD3-APC, and anti-B220-PE, were purchased from BioLegend and used as described [1 (link)]. The manufacturers and catalog numbers for other antibodies and reagents are as follows: anti-PirB-PE, R&D Systems, FAB2754P; pCAMKI, Santa Cruz, sc-28438; anti-pCAMKII, Abcam, ab32678; anti-pCAMKIV, Santa Cruz Biotechnology, sc-28443-R; anti-CAMKI, Abcam, ab68234; anti-CAMKII, Cell Signaling, 4436; anti-CAMKIV, Cell Signaling, 4032; anti-pCREB, Cell Signaling, 9198S; anti-CREB, Cell Signaling, 9197S; anti-actin, Sigma Aldrich, A2066; STO-609, Sigma Aldrich, S1318; KN93, Sigma Aldrich, K1385; The PCR primer sequences were as follows: hCAMKI forward: CGGAGGACA TTAGAGACA, reverse: CTCGTCATAGAAGGGAGG-3; hCAMKIV forward: GATGAAAGAGGCGATCAG, reverse: TAGGCCCTCCTCTAGTTC. PirB forward: GAG AATCACCAGACACATGC, PirB reverse: CTGCCCTCATGTCTTAACTT, mCAMKIV forward: AAGCAGGCGGAAGACATTAGG, CAMKIV reverse: AGTTTCTGAGTCCTCTTGTCCT.
+ Open protocol
+ Expand
2

Sperm Viability Assay with AMPK Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
All chemicals were purchased from Sigma–Aldrich (St Louis, MO, USA) unless otherwise noted. Complete mini EDTA-free, protease inhibitor cocktail tablets were from Roche diagnostics (Mannheim, Germany). Tris/glycine buffer (10X), Tris/glycine/SDS buffer (10X), and Precision Plus Protein All Blue Standards (Catalog #161–0373) were obtained from Bio-Rad (Hercules, CA) and anti-AMPKα from Millipore (Billerica, MA), anti-phospho-Thr172-AMPKα, anti-CaMKIV, and anti-rabbit IgG (H+L) (DyLight 680 Conjugate) from Cell Signaling Technology, Inc (Danvers, MA). Anti- CaMKKβ and anti-CaMKKα were obtained from Abgent INC (San Diego, CA). Anti-CaMKI and anti-phospho-Thr177-CaMKI were obtained from Novus Europe (Cambridge, UK). Anti-phospho-Thr196-CaMKIV was obtained from Santa Cruz Biotechnology, INC (Texas, USA). PI/Sybr-14 (LIVE/DEAD sperm viability kit) was purchased from Molecular Probes (Saint Aubin, France).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!