Log In Sign up
The largest database of trusted experimental protocols

Q pcr system

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States, Finland

The Q-PCR system is a laboratory instrument used for quantitative polymerase chain reaction (qPCR) analysis. It is designed to accurately measure and amplify target DNA sequences. The system provides precise temperature control and real-time detection of fluorescent signals to enable quantitative analysis of DNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Tripure rna isolation reagent, by Roche (1 mentions)

Close spelling variants of this product

StepOnePlus™Q-PCR detection system (5 citations) QuantStudio Absolute Q Digital PCR System (4 citations) QS DX Real-time PCR system (2 citations)

4 protocols using q pcr system

1

Exploring H. pylori-Candida Symbiosis

Check if the same lab product or an alternative is used in the 5 most similar protocols
To explore the possible benefits of the endosymbiotic H. pylori inside C. albicans in terms of protection from antibiotics and environmental stresses, amoxicillin, and an aerobic (high-oxygen) condition, which is a stress factor for microaerophilic H. pylori (i.e., it has the ability to grow in 5–15% oxygen), were tested. As such, the second generation of Candida yeast cells was cultured into SB with or without amoxicillin (0.06 and 8 ug/mL) (Tianjin TEDA Steyuan Pharm Co., Ltd., Shijiazhuang, Hebei, China) in aerophilic conditions (21% oxygen) at 37 °C overnight. Then, 100 μL of each sample was plated onto SDA and incubated in aerophilic conditions at 37 °C overnight. After that, the whole DNA was extracted to identify CagA gene expression in each experimental group using a qPCR system (Thermo Fisher Scientific).
Hiengrach P., Panpetch W., Chindamporn A, & Leelahavanichkul A. (2022). Helicobacter pylori, Protected from Antibiotics and Stresses Inside Candida albicans Vacuoles, Cause Gastritis in Mice. International Journal of Molecular Sciences, 23(15), 8568.
+ Open protocol
+ Expand
2

Mitochondrial DNA Copy Number Quantification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total genomic DNA was extracted from LCLs and relative mitochondrial DNA (mtDNA) copy number was estimated by SYBR Green assay in a q-PCR system (Thermofisher). Cytochrome B (Cyt B) and NADH dehydrogenase 1 (ND1) genes were used to represent the mtDNA, and pyruvate kinase (PK) gene was used to represent the nuclear DNA. The primers selected for this experiment were based on an earlier study for mtDNA copy number by Gu et al.24 (link). Relative mtDNA copy numbers of the genes Cyt B and ND1, normalized to the single-copy nuclear gene PK and relative to the calibrator is given by 2−ΔΔCt.
Paul P., Iyer S., Nadella R.K., Nayak R., Chellappa A.S., Ambardar S., Sud R., Sukumaran S.K., Purushottam M., Jain S, & Viswanath B. (2020). Lithium response in bipolar disorder correlates with improved cell viability of patient derived cell lines. Scientific Reports, 10, 7428.
+ Open protocol
+ Expand
3

Molecular detection of biofilm genes in A. baumannii

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
In the current investigation, we used qPCR System (Thermo Fisher Scientific, USA) for amplification of 16S-23S ribosomal DNA and the biofilm-related genes were revealed in Table 1. Briefly, a 16 µl reaction volume comprising 10 µl of oasig or PrecisionPLUS 2X qPCR Master Mix, 1 µl A. baumannii primer/probe mix, 1 µl internal extraction control primer/probe mix, 1 µl target DNA, and 1 µl of purified water were applied. All reactions were run two times. The magnification protocol was achieved as enzyme activation at 95 °C for 2 min, denaturation at 95 °C for 10 s, data collection at 60 °C for 60 s, all was achieved for 50 amplification cycles. Amplification outcomes were stated by plotting Delta Rn (ΔRn).

Oligonucleotide sequences utilized for detection of biofilm-related virulence genes in A. baumannii.

Target genePrimer sequences (5ʹ-3ʹ)Base pairReference
ompAGTTAAAGGCGACGTAGACG578Smani et al. (2014) (link)
CCAGTGTTATCTGTGTGACC
bapATGCCTGAGATACAAATTAT1449Badmasti et al. (2015) (link)
GTCAATCGTAAAGGTAACG
blaPER-1ATGAATGTCATTATAAAAGC925Strateva et al. (2007) (link)
AATTTGGGCTTAGGGCAGAA
csuECATCTTCTATTTCGGTCCC168Azizi et al. (2016) (link)
CGGTCTGAGCATTGGTAA
csgAACTCTGACTTGACTATTACC200Darvishi (2016)
AGATGCAGTCTGGTCAAC
fimHTGCAGAACGGATAAGCCGTGG508Johnson & Stell (2000) (link)
GCAGTCACCTGCCCTCCGGTA
16S–23SrDNACATTATCACGGTAATTAGTG208Askari et al. (2019) (link)
AGAGCACTGTGCACTTAAG
Elbehiry A., Marzouk E., Moussa I.M., Dawoud T.M., Mubarak A.S., Al-Sarar D., Alsubki R.A., Alhaji J.H., Hamada M., Abalkhail A., A. Hemeg H, & Zahran R.N. (2020). Acinetobacter baumannii as a community foodborne pathogen: Peptide mass fingerprinting analysis, genotypic of biofilm formation and phenotypic pattern of antimicrobial resistance. Saudi Journal of Biological Sciences, 28(1), 1158-1166.
+ Open protocol
+ Expand
4

Comprehensive analysis of signaling pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted with Tripure RNA Isolation Reagent (Roche, Switzerland) from NPCs and reverse transcribed into cDNA with cDNA synthesis kit (Thermo Fisher Scientific, Inc, Rockford, IL) according to the manufacturer’s recommendations. We performed qPCR quantification of mRNA levels for genes belonging to Wnt signaling pathway (Axin1, β-catenin, Dvl2, Fzd1, Fzd4, LEF1, and TCF3), autophagy (Atg5, Beclin1, mTOR, and mTORC1), cell cycles (c-Myc, CyclinD1 (CCND1), and apoptosis (Bax and Bcl2). The mRNA amplifications were conducted using a q-PCR system (Thermo Fisher Scientific, Vantaa, Finland) according to the previously study (Chang et al., 2013 (link)). Data were normalized to housekeeping gene (PPIA) expression. Each sample was done in triplicate and the 2−△△Ct was applied for RNA relative expression quantification. The primers for various amplified genes are listed in Table 1.
Zhao L., Yan M., Wang X., Xiong G., Wu C., Wang Z., Zhou Z, & Chang X. (2018). Modification of Wnt signaling pathway on paraquat-induced inhibition of neural progenitor cell proliferation. Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 121, 311-325.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!