Total RNA from embryos was prepared using the TRIzol reagent (Invitrogen) extraction method [34 (link)]. Embryonic hearts at specific developmental ages were collected in Trizol and homogenized using a 26½ gauge syringe. First strand cDNA was made using the Superscript II RT-PCR (Invitrogen, 11,904–018) protocol with 100 ng of total RNA for conversion. Each RT-qPCR reaction had a 10 μl final volume containing 0.5 μl of cDNA, 500 nM of each primer and 5 μl of SYBR Green QuantiFast RT-qPCR master mix (Qiagen). Primers used were: bmp4a (F: 5’ – GACCCGTTTTACCGTCTTCA; R: 5’- TTTGTCGAGAGGTGATGCAG); irx1a (F: 5’- CAAGATGACCCTCACGCAAG; R: 5’- CCAGGTCACCTTGTTCTCCT); tbx5a (F: 5’- AACCATCTGGATCCCTTCG; R: 5’- TGTTTTCATCCGCCTTGAC). An Applied Biosystems QuantiStudio 6 Real-Time PCR system was used, and gene expression was normalized relative to ß-actin (F: 5’-GCAGAAGGAGATCACATCCCTGGC; R: 5’- CATTGCCGTCACCTTCACCGTTC). Reactions were performed in three technical replicates, and all results made from 3–4 independent biological replicates.
Quantistudio 6 real time pcr system
Manufactured by Thermo Fisher Scientific
The QuantiStudio 6 Real-Time PCR system is a compact and powerful device designed for real-time polymerase chain reaction (PCR) analysis. It enables precise quantification and detection of target DNA or RNA sequences. The system features a thermal cycler and fluorescence detection capabilities for high-throughput, sensitive, and reproducible real-time PCR experiments.
Automatically generated - may contain errors
2 protocols using quantistudio 6 real time pcr system
1
Cardiac Gene Expression Analysis in Zebrafish Embryos
2
Embryonic RNA Extraction and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from embryos was prepared using the TRIzol reagent (Invitrogen) extraction method 29 (link) . Briefly, 5 embryos or embryonic hearts at specific developmental ages were collected in Trizol and homogenized using a 26½ gauge syringe. First strand cDNA was made using the Superscript II RT-PCR (Invitrogen, 11904-018) protocol with 100 ng of total RNA for conversion. Each RT-qPCR reaction had a 10 µl final volume containing 0.5 µl of cDNA, 500 nM of each primer and 5 µl of SYBR Green QuantiFast RT-qPCR master mix (Qiagen). Primers used were: sema3fb (F: 5'-AGTGACGCATATGGCTCTGC; R: -5'-AGGAAGCCTCTTCTGCGAGG); bmp4a (F: 5' -GACCCGTTTTACCGTCTTCA; R: 5'-TTTGTCGAGAGGTGATGCAG) (Morris et al., 2011); tbx5a (F: 5'-AACCATCTGGATCCCTTCG; R: 5'-TGTTTTCATCCGCCTTGAC). An Applied Biosystems QuantiStudio 6 Real-Time PCR system was used, and gene expression was normalized relative to reference gene ß-actin (F: 5'-GCAGAAGGAGATCACATCCCTGGC; R: 5'-CATTGCCGTCACCTTCACCGTTC). Reactions were performed in three technical replicates, and all results made from 3-4 independent biological replicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!