Abi prism 3100 genetic analyzer dna sequencer

The genomic DNA was extracted using NucleoSpin Tissue (Macherey-Nagel, Dueren, Germany) kit. Check-MDR CT103XL (Check-Points Health B.V., Wageningen, The Netherlands) microarray was used for antimicrobial resistance genes investigation as described elsewhere [31 (link)]. PCR and sequencing were performed to assess the specific allelic variant of the beta-lactamase genes. The primers’ sequences and PCR conditions used for the detection of the blaKPC, blaVIM, blaNDM, blaCTX-M, blaTEM and blaSHV genes were run as previously described [9 (link)]. PCR products were purified using the quantum PrepPCR Kleen Spin Columns kit (ThermoFisher Scientific) and subjected to double-strand sequencing using the automatic sequencer ABI PRISM 3100 genetic analyzer DNA Sequencer (Applied Biosystems, Foster City, CA, USA) and the BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA). The sequences were analyzed according to the BLAST software program (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 1 February 2021).

Genotypes were determined in samples with viral load >1000 copies/ml (HBV or HDV). HDV genotype was determined following PCR amplification of the whole HDAg region with ORF891F 5’- ATGCCGACCCGAAGAGGA-3’ and ORF1680R 5’- GTCCAGCRGTCTCCTCTTTA-3’ by single step RT-PCR using 7 μl HDV RNA and sequencing with previously published primers [13 (link), 15 (link)]. Genotyping of HBV was performed following PCR amplification of a fragment from the polymerase region with 2F-5-‘GCGGGCCGGCTACTCTTCTTTC and 6r 5’-GTGGGGGTTGCGTCAGCAAA-3’ with 5μl HBV DNA. Direct sequencing of all PCR products was performed using an automatic sequencer (ABI PRISM 3100 genetic analyzer DNA Sequencer, Applied Biosystems, Foster City, CA, USA) and BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).

HCV RNA was measured by reverse transcription followed by real-time PCR using the GeneXpert assay (Cepheid, Sunnyvale CA, U.S) with a LLoQ of 10 IU/mL and lower limit of detection of 4 IU/mL. SVR was defined as undetectable serum HCV RNA 12 or 24 weeks after stopping antiviral treatment.
HCV genotyping was performed by the Abbott RealTime HCV Genotype II assay. This assay uses four sets of PCR primers. One set of primers targets a region within the 5′ untranslated region of the HCV genome that is recognized by GT-specific fluorescent-labeled probes. To subtype GT1, a second primer set is designed to amplify the nonstructural 5b region of genotype 1a and a third primer set is designed to amplify the nonstructural 5b region of genotype 1b (Abbott, Chicago, Illinois, USA).
In the single patient who relapsed, serum drug-resistant viral variants carrying resistant-associated substitutions (RAS) in the NS3 and NS5A regions, were explored by population (Sanger) sequencing^{19 (link)} (ABI PRISM 3100 genetic analyzer DNA Sequencer, Applied Biosystems, Foster City, CA, USA) and BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA).