Quantitative real time polymerase chain reaction

Manufactured by Thermo Fisher Scientific

The Quantitative real-time Polymerase Chain Reaction is a laboratory instrument used for the amplification and quantification of specific DNA or RNA sequences. It enables the measurement of the amount of a target nucleic acid sequence in a sample during the PCR process.

Automatically generated - may contain errors

Lab products found in correlation

Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

TaqMan real‐time quantitative polymerase chain reaction (2 citations) PowerUp™ SYBR™ Green Master Mix mRNA quantitative real-time polymerase chain reaction Kit (2 citations)

3 protocols using quantitative real time polymerase chain reaction

Gene Expression Analysis in Rat Mesenteric Arteries

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative real-time Polymerase Chain Reaction (Applied Biosystems) was used to analyze mRNA expression in rat mesenteric arteries; data are expressed as target gene/18 s housekeeping gene. Transcript expression in rat VSMCs was normalised to GAPDH, using Qiagen QuantiTech primer assays (Qiagen, UK). Relative gene expression was calculated by 2^ΔΔCt method, and the results were reported as arbitrary units relative to the control conditions. Primers were designed using Primer3 software with sequences as shown in Table 1.Table 1

Primers targeted to rat genes for qRT-PCR analysis.

Table 1

Rat gene	Forward primer	Reverse primer
Nox1	TCCCTTTGCTTCCTTCTTGA	CCAGCCAGTGAGGAAGAGTC
NoxA1	TTACTGTGCCCCTGAAGGTC	CTCGGGCTTTGTAGCTGAAC
NoxO1	TCCAGACGTTTGCCTTCTCT	CGTGTCAACAATGGAGCATC
Nox2	ACCCTTTCACCCTGACCTCT	TCCCAGCTCCCACTAACATC
Nox4	CCAGAATGAGGATCCCAGAA	AGCAGCAGCAGCATGTAGAA
P22phox	TTGTTGCAGGAGTGCTCATC	CAGGGACAGCAGTAAGTGGA
P47phox	AGCTCCCAGGTGGTATGATG	ATCTTTGGCCGTCAGGTATG
MMP2	AGCTCCCGGAAAAGATTGAT	TCCAGTTAAAGGCAGCGTCT
MMP9	CACTGTAACTGGGGGCAACT	CACTTCTTGTCAGCGTCGAA
MCP-1	CAGTTAATGCCCCACTCACC	TTCCTTATTGGGGTCAGCAC
RANTES	ATATGGCTCGGACACCACTC	CCACTTCTTCTCTGGGTTGG
18S	AAGTCCCTGCCGTTTGTACACA	GATCCGAGGGCCTCACTAAAC

Harvey A.P., Montezano A.C., Hood K.Y., Lopes R.A., Rios F., Ceravolo G., Graham D, & Touyz R.M. (2017). Vascular dysfunction and fibrosis in stroke-prone spontaneously hypertensive rats: The aldosterone-mineralocorticoid receptor-Nox1 axis. Life Sciences, 179, 110-119.

+ Open protocol

+ Expand

Tissue RNA Extraction and Quantification

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

250 mg of frozen liver tissue and 100 mg of frozen spinal cord epicenters were homogenized in Trizol Reagent (15,596,018, Life Technologies) to preserve nucleic acids. Samples were frozen at −80 °C until used. RNA was isolated by a standard extraction protocol using chloroform/phenol (Almad and McTigue, 2010 (link); Sauerbeck et al., 2015 (link)). The purity of all samples was assessed prior to amplification using microdrop spectrophotometry. The extracted RNA was synthesized into cDNA using Superscript III reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. Expression of specific genes was assessed using quantitative Real Time Polymerase Chain Reaction (Applied Biosystems). Each qPCR reaction used 100 ng of cDNA with QuantiTec primers for tumor necrosis factor α (TNFα), interleukin-1 alpha (IL-1α), interleukin-1 beta (IL-1β), Fetuin-A and SYBR green for detection (Table 1). The amplification of each sample was normalized using Quantum RNA18S (Applied Biosystems) gene expression as a control standard. The relative mRNA expression in each sample was determined with the ΔΔCT method and reported as fold-change vs. Sham controls (Schmittgen and Livak, 2008 (link)).

Goodus M.T., Carson K.E., Sauerbeck A.D., Dey P., Alfredo A.N., Popovich P.G., Bruno R.S, & McTigue D.M. (2021). Liver inflammation at the time of spinal cord injury enhances intraspinal pathology, liver injury, metabolic syndrome and locomotor deficits. Experimental neurology, 342, 113725.

+ Open protocol

+ Expand

Methane-enriched cardioprotection in HTX

Check if the same lab product or an alternative is used in the 5 most similar protocols

Myocardial mRNA expression was analyzed by quantitative real-time polymerase chain reaction (Applied Biosystems, Foster City, CA) for the following genes: caspase-3, caspase-9, DNA damage-inducible transcript 3 (Ddit3; also known as CCAAT/enhancer binding protein [C/EBP] homologous protein [CHOP]), hypoxia-inducible factor 1-alpha (HIF1a), glycogen synthase kinase-3b (GSK-3b), and very low-density lipoprotein receptor (VLDLr). Experimental protocol. The heart grafts were explanted from the donors and stored for 60 minutes in cold preservation solution before heterotopical HTX. At 60 minutes after the start of reperfusion, hemodynamic measurements were performed in the recipients to evaluate early post-transplant graft function. Thereafter, samples were taken from the left ventricle for mitochondrial functional measurements, biochemical assays, qPCR analysis, and histology. Hearts in the control group underwent the same surgical procedure as those of the donors but were not subjected to cold storage and transplantation. Grafts in the CS group were stored in cold (4˚C) CS solution during the cold ischemia period; in the CS-CH 4 group, the protocol was identical, except that CH 4 -enriched CS solution was used. CH 4 , methane; CS, Custodiol; HTX, heart transplantation; qPCR, quantitative real-time polymerase chain reaction.

Benke K., Jász D.K., Szilágyi Á.L., Baráth B., Tuboly E., Márton A.R., Varga P., Mohácsi Á., Szabó A., Széll Z., Ruppert M., Radovits T., Szabó G., Merkely B., Hartmann P, & Boros M. (2021). Methane supplementation improves graft function in experimental heart transplantation. The Journal of heart and lung transplantation : the official publication of the International Society for Heart Transplantation, 40(3).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!