Suspension CHO (CHO DG44, Gibco, hereinafter termed susCHO) cells were cultured in CD DG44 medium (Gibco) supplemented with 8 mM l -glutamine (Gibco) and 0.18% Pluronic® F-68 prior to transfection. Transfection was performed by combining 18 μg AhdI-linearized plasmid pOpti_IL2_S377-588-Fc and 15 μL of FreeStyle™ MAX Reagent (Invitrogen) in 1.2 mL OptiPRO SFM and incubated at room temperature for 10 min, followed by dropwise addition to 1.5 × 107 cells in 30 mL of CD DG44 culture medium (non-selective) according to the manufacturer’s instructions. After 48 h, cells were transferred to selective medium (CD OptiCHO, Invitrogen), supplemented with 8 mM l -glutamine and 0.18% Pluronic® F-68 (Gibco), and cultivated until cell viability reached 90%. After selection, stably transfected susCHO cells underwent DNA amplification by gradually increasing MTX concentration (20–5000 nM) in selective medium. All suspension culture flasks were maintained in a humidified incubator, 37 °C/8% CO2 on a shaker, at a constant rotation rate of 135 rpm.
Pluronic f 68
Manufactured by Thermo Fisher Scientific
Sourced in United States, Canada, United Kingdom
Pluronic F-68 is a non-ionic surfactant. It is commonly used in cell culture and bioprocessing applications to protect cells from mechanical and interfacial stress.
Automatically generated - may contain errors
Lab products found in correlation
L glutamine, by Thermo Fisher Scientific (14 mentions)
Glutamax, by Thermo Fisher Scientific (6 mentions)
Pei max, by Polysciences (6 mentions)
Geneticin, by Thermo Fisher Scientific (5 mentions)
Penicillin, by Thermo Fisher Scientific (5 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (4 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions)
Freestyle f17 expression medium, by Thermo Fisher Scientific (4 mentions)
Streptomycin, by Thermo Fisher Scientific (4 mentions)
50 kda filters, by Merck Group (4 mentions)
Cd dg44 medium, by Thermo Fisher Scientific (3 mentions)
Benzonase nuclease, by Merck Group (3 mentions)
Erlenmeyer flask, by Corning (3 mentions)
Cd opticho medium, by Thermo Fisher Scientific (3 mentions)
Fetal bovine serum (fbs), by Merck Group (3 mentions)
Benzonase, by Merck Group (3 mentions)
Non essential amino acids (neaa), by Thermo Fisher Scientific (3 mentions)
Liberase enzyme mix, by Merck Group (3 mentions)
Freestyle max reagent, by Thermo Fisher Scientific (2 mentions)
Cd opticho, by Thermo Fisher Scientific (2 mentions)
128 protocols using pluronic f 68
1
Suspension CHO Cell Transfection and Amplification
2
Suspension CHO Cell Transfection and Amplification
3
Cell Culture Protocols for Cancer Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Vero cells used in this study were from a Mayo Clinic VVPL cGMP cell bank grown in DMEM supplemented with 5% fetal bovine serum.
The suspension HeLaS3 cells used in this study were from a Mayo Clinic VVPL cell bank and adapted to serum-free medium 293 SFM II (Gibco Invitrogen) supplemented with 4 mM GlutaMAX-I (Gibco) and 0.1% Pluronic F68 (Thermo Fisher Scientific, Waltham, MA) and grown in shake flasks.
The LaSt 293 HEK cell line used in this study is a robust suspension HEK293 cell line generated by the Mayo Clinic VVPL by adapting a GMP HEK293 adherent cell line to serum-free growth conditions using serum-free protein expression medium (PEM; Gibco Invitrogen) supplemented with 4 mM GlutaMAX-I (Gibco) and 0.1% Pluronic F68 (Thermo Fisher Scientific, Waltham, MA) and grown in shake flasks and WAVE bioreactors.
The established cancer cell lines used in this work were purchased from the ATCC (Manassas, VA) and were maintained in medium recommended by the ATCC at 37°C and 5% CO2: the breast cancer cell lines MDA-MB-468, MDA-MB-231, BT549, Hs578T, MCF7, T47D, ZR-75-1, BT474, and SKBR3; the pancreatic cancer cell line BxPC3; and the lung cancer cell line A549.
The generation of breast cancer PDX cell lines and growth of these breast cancer PDX lines as 3D organoids have been described previously.19 (link),20 (link),21 (link),22 (link),23 (link)
The suspension HeLaS3 cells used in this study were from a Mayo Clinic VVPL cell bank and adapted to serum-free medium 293 SFM II (Gibco Invitrogen) supplemented with 4 mM GlutaMAX-I (Gibco) and 0.1% Pluronic F68 (Thermo Fisher Scientific, Waltham, MA) and grown in shake flasks.
The LaSt 293 HEK cell line used in this study is a robust suspension HEK293 cell line generated by the Mayo Clinic VVPL by adapting a GMP HEK293 adherent cell line to serum-free growth conditions using serum-free protein expression medium (PEM; Gibco Invitrogen) supplemented with 4 mM GlutaMAX-I (Gibco) and 0.1% Pluronic F68 (Thermo Fisher Scientific, Waltham, MA) and grown in shake flasks and WAVE bioreactors.
The established cancer cell lines used in this work were purchased from the ATCC (Manassas, VA) and were maintained in medium recommended by the ATCC at 37°C and 5% CO2: the breast cancer cell lines MDA-MB-468, MDA-MB-231, BT549, Hs578T, MCF7, T47D, ZR-75-1, BT474, and SKBR3; the pancreatic cancer cell line BxPC3; and the lung cancer cell line A549.
The generation of breast cancer PDX cell lines and growth of these breast cancer PDX lines as 3D organoids have been described previously.19 (link),20 (link),21 (link),22 (link),23 (link)
4
Cultivation of CHO-K1 and SH87 Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHO-K1 cells (American Type Culture Collection, Manassas, VA) adapted to maltose-only HyQ PF-CHO MPS (HyClone, Logan, UT)11 (link) was further adapted into a DMEM/F12-based protein free chemically defined medium (PFCDM) supplemented with 10 g/L D-(+)-Maltose monohydrate (Sigma-Aldrich), 8 mM L-Glutamine (Sigma-Aldrich) and 0.1% Pluronic® F-68 (Life Technologies, Carlsbad, CA). An anti-Her2 monoclonal antibody-producing CHO-K1 cell line (SH87)13 (link) was cultivated in PFCDM supplemented with 6 g/l D-(+)-Glucose (Sigma-Aldrich), 8 mM L-Glutamine (Sigma-Aldrich), 0.1% Pluronic F-68 (Life Technologies), and 600 µg/ml G418 disulfate salt (Sigma-Aldrich). Passaging of CHO-K1 and SH87 cells were performed every 3 to 4 days as reported previously11 (link).
5
Large-Scale Purification of AAV Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AAV-PHP.eB viruses were packaged in AAVpro 293T cells (Clontech, 632273). Cells were harvested by cell lifter (Biologix, 70-2180) at 72 h after cotransfection with PHP.eB (Addgene, 103005), pAdDeltaF6 (Addgene, 112867) and transfer plasmids using polyethylenimine MAX (Polysciences, 24 765). Cell pellets were suspended in 1× gradient buffer (10 mm Tris-HCl, pH 7.6, 150 mm NaCl, 10 mm MgCl2). Cells were lysed by five repeated cycles of freezing in liquid nitrogen for 7 min, thawing in 37°C water bath for 3 min, and vortexing for 2 min. Cell lysate was mixed with ≥50 U/ml of Benzonase nuclease (Millipore, E1014) and incubated at 37°C for 30 min. After centrifugation at 20,000 × g for 30 min at 4°C, the supernatant was transferred to a iodixanol (Optiprep, D1556) step gradient (15%, 25%, 40%, and 58%) for ultracentrifugation. After centrifugation at 40,000 rpm for 4 h at 4°C, virus particles were collected from the layer of 40% iodixanol gradient using a sterile syringe. Purified AAVs were concentrated using Amicon filters (EMD, UFC801096) and formulated in sterile PBS supplemented with 0.01% Pluronic F68 (Invitrogen, 24040032). Virus titers were determined by qPCR using a linearized AAV plasmid as a standard.
6
Suspension Cell Culture Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All culture media was supplied by Invitrogen (UK) and supplemented with 8 mM L-glutamine (25030-024, Invitrogen) unless otherwise stated. CD DG44 medium (12610-010, Invitrogen) was supplemented with 1.8 % Pluronic F68 (24040-032, Invitrogen) prior to use. All cells were incubated at 37 °C with 8 % CO2 in vented Erlenmeyer flasks (431143, 431144, 431145, Corning, Netherlands), with shaking on a Labnet orbital 1000 shaking platform (ST2060, Appleton Woods Ltd., UK) rotating at 135 rpm unless otherwise stated. Cells were passaged by centrifugation at 300 g for 5 minutes and re-suspension in appropriate medium, and cell numbers and viabilities were determined using a hemocytometer and Trypan blue exclusion, respectively.
7
Quantitative Viral Titer Determination
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Titration of different AAV vectors was performed by droplet digital PCR (ddPCR) as previously described.71 (link) Briefly, purified vectors were diluted 10-fold and treated with DNase I (Roche Applied Science, Indianapolis, IN) at 400 U/mL for 30 min at 37°C. Treated samples were then diluted to within the detectible range of ddPCR using the dilution buffer (1x PCR buffer [Applied Biosystems, Foster City, CA], 2-ng/μL sheared salmon sperm DNA [Invitrogen, Carlsbad, CA], and 0.05% Pluronic F-68 [Invitrogen]). The reaction mixtures were assembled with the recommended ddPCR supermix (Bio-Rad, Hercules, CA), appropriate primers and probes (Table 1 ), and template (5 μL) in a final volume of 20 μL. Droplets were generated, then transferred to a 96-well PCR plate and amplified to the endpoint (50 cycles) with a conventional thermal cycler. The PCR reactions were read on a QX200 droplet reader (Bio-Rad), and the data were analyzed with QX Manager software (Bio-Rad). The viral titer was calculated as previously described.71 (link) See also Table S1 .
Droplet digital PCR primers and probes
| GFP forward primer (900 nM) | 5′CCACTACCTGAGCACCCAGTC |
| GFP reverse primer (900 nM) | 5′TCCAGCAGGACCATGTGATC |
| GFP probe (250 nM) | FAM-TGAGCAAAGACCCCAACGAGAAGCG |
nM, nano-molar.
8
Src Kinase Activation Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ni-NTA was from Qiagen (Valencia, CA). IPL-41 and pluronic F-68 for growing Sf9 cells were from Invitrogen (Carlsbad, CA). Mutagenesis primers were from Integrated DNA Technologies (Coralville, IA). Cloning and mutagenesis reagents, Protein A/G-Sepharose, and FastAP alkaline phosphatase were from Thermo Scientific. Anti-FLAG affinity resin (M8823), 3X FLAG peptide (F4799), and anti-FLAG antibody (F7425) were from Sigma. Anti-Src antibody was from Santa Cruz (sc-18). Anti-phosphotyrosine 4G10 Platinum antibody was from Millipore. Phosphatidylinositol 4,5-bisphosphate (PIP2) and brominated phosphatidylcholine (PC), were from Avanti Polar Lipids. [γ-32P]GTP and [γ-32P]ATP were from PerkinElmer Life Sciences. Reagents for electrophoresis and immunoblotting were from Bio-Rad. Fluorescently labeled secondary antibodies for Infrared Imaging System were from LICOR. Other reagents, including anti-myc antibodies, buffers, charcoal-activated Norit A, GSH-Agarose, glutathione, ATP, GTP, protease inhibitors and PMSF were from Sigma (St. Louis MO). pCMV5 mouse Src was from Addgene (plasmid #13663, provided by Joan Brugge and Peter Howley).
9
Efficient HDAC6 Variant Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All HDAC6 variants were expressed using HEK-293/T17 cells following transient transfection mediated by linear polyethylene imine (PEI) (Polysciences Inc., Warrington, PA, USA). To this end, the suspension culture of HEK-293/T17 cells was grown in 2 L Erlenmeyer flasks in Free Style F17 medium (Thermo Fisher Scientific) supplemented by 0.1% Pluronic F-68 (Invitrogen) and 2 mM L-glutamine at 110 rpm under a humidified 5% CO2 atmosphere at 37 °C. For large-scale expression, 0.7 mg of an expression plasmid was diluted in 17.5 ml of PBS, to which 2.1 ml of 1 mg/ml PEI was added. The mixture was vortexed briefly, incubated for 10 min at room temperature, and then added to 350 ml of cells at a concentration of 4 × 106 cell/ml. Four hours post-transfection, the cell suspension was diluted by an equal volume of ExCell serum-free medium. Cells were harvested 72 h post transfection by centrifugation at 500 × g for 5 min, then the cell pellet was frozen in liquid nitrogen and stored at −80 °C until further use.
10
CHO Cell Culture for Her2 Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHO cells producing Her2 were kindly provided by Polpharma (Polpharma Biologics B.V., Utrecht, The Netherlands). CHO cells were cultured in serum-free ProCHO medium (Lonza, Verviers, Belgium) supplemented with 2% pluronic F68 (Invitrogen, Carlsbad, USA) and 4mM L-glutamine. For passaging, suspension cultures were harvested by thorough pipetting, and cells were pelleted by centrifugation and resuspended in fresh complete medium. Subsequently, cell number and viability were determined by incubation of the cells with 4% Trypan blue (Invitrogen, Carlsbad, USA) and counted on a Luna-FL™ automated cell counter (Logos Biosystems, Westburg B.V., Leusden, the Netherlands). Cells were cultured in T25 non-treated culture flasks (VWR international B.V, Amsterdam, the Netherlands) suitable for suspension cultures at a density of 2 × 105 cells/mL in a humidified incubator at 37°C under 5% CO2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!