TRIzol reagent was used (Invitrogen Life Technologies, Carlsbad, CA) to extract the total RNA from sample tissues. Agarose gel electrophoresis was applied to estimate RNA integrity, and thermo ND-1000 ultramicro nucleic acid protein meter (OD 260 nm; Thermo, Waltham, MA) was used to evaluate RNA quantity. cDNA was constructed using a Transcriptor First Strand cDNA Synthesis Kit (Bio fact, Korea), and 9 μl of total RNA for each sample was applied. Expression analysis was performed by real-time PCR with SYBR Green (Bio fact, Korea) and using the Rotor-Gene 6000 system, with the following conditions: (a) 95°C for 15 min; (b) 40 cycles of 95°C for 20 s and 60°C for 30 s; and (c) 72°C for 30 s. Then, the relative gene expression was calculated using the 2−ΔΔCt method normalized to GAPDH. Plus, each sample was examined in triplicate.
Sybr green
Manufactured by Biofact
SYBR Green is a fluorescent dye used in real-time PCR (polymerase chain reaction) assays. It binds to double-stranded DNA and emits a fluorescent signal upon binding, allowing for the quantification of DNA amplification during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Thermo nd 1000 ultramicro nucleic acid protein meter, by Thermo Fisher Scientific (2 mentions)
Transcriptor first strand cdna synthesis kit, by Biofact (2 mentions)
Rotor gene 6000 system, by Biofact (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Abi steponeplus thermal cycler, by Thermo Fisher Scientific (2 mentions)
Total rna prep kit, by Biofact (2 mentions)
Cdna synthesis kit, by Biofact (2 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Riboex reagent, by GeneAll (1 mentions)
Steponeplus instrument, by Thermo Fisher Scientific (1 mentions)
Cdna synthesis kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Nanodrop instrument, by Thermo Fisher Scientific (1 mentions)
8 protocols using sybr green
1
RNA Extraction and Real-Time PCR Analysis
2
Real-Time qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RiboEx reagent (Geneall, Korea) according to the manufacturer’s instructions. cDNA synthesis was performed using a Biofact2X RT-PCR Master Mix (high ROX) containing SYBR Green (Biofact, Korea). In the present study, the expression of all genes was evaluated using SYBR Premix Ex Taq II (TAKARA, Japan) and the Applied Biosystems StepOnePlus™ Real-Time PCR System (Life Technologies, Carlsbad, CA, USA). β-Actin and U6 RNA were used as internal controls to normalize the expression of candidate genes and microRNAs, respectively using 2ΔΔCt formula. Before experiments, all primers were blasted using the Primer Blast section of the NCBI website (http://www.nchi.nlm.nih.gov accessed on 30 December 2020). Table 2 shows the sequence of forward and reverse primers. All experiments were performed in triplicate.
3
Quantitative ANRIL Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific PCR primers were designed using Gene Runner (version 6.5.51) and Primer3, synthesized by Macrogen (Korea) (S1 Table). The primers were designed for different exons of ANRIL (RefSeq NR_003529.3): one pair on exon one, one on exon five-six, and one on exon 19 (Fig. 1 ). The real-time PCR analysis was performed using the BioFACT 2X Real-Time PCR Master Mix (High ROX), including SYBR Green (BioFACT, South Korea), in an Applied Biosystems StepOne Plus instrument (Applied Biosystems, USA). Next, cDNA was added to 10 μL of SYBR Green and 0.5 μM of each primer in a 20 μL reaction. All the reactions were repeated in duplicates, and mean threshold cycles were used for further analyses. The real-time thermal program was as follows: 95 °C for 30 s and 62 °C for 35 s, for which 5srRNA was utilized as an internal control. The expression level was calculated by 2−ΔCt.
4
Transcriptional Profiling of Plant Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from leaf samples using the TRI-SolutionTM Reagent (Cat. No: TS200-001, Virginia Tech Biotechnology, Lot: 337871401001), as recommended by the manufacturer’s protocol. Thereafter, the complementary DNA (cDNA) was synthesized as described earlier [49 (link)]. Briefly, 1 µg of RNA was used to synthesize cDNA using BioFACTTM RT-Kit (BioFACTTM, Daejeon, Korea) according to the manufacturer’s standard protocol. The cDNA was then used as a template in qRT PCR to study the transcript accumulation of selected genes (Table S1 ) using a real-time PCR master mix including SYBR green (BioFact, Korea) along with 100 ng of template DNA and 10 nM of each forward and reverse primer in a final reaction volume of 20 µL. A no-template control was used as a control. A 2-step reaction, including polymerase activation at 95 °C for 15 min, followed by denaturation at 95 °C for 5 s, and annealing and extension at 65 °C for 30 s, was performed in a real-time PCR machine (Eco™ Illumina, San Diego, CA, USA). Total reaction cycles were 40 and the data were normalized with a relative expression of Arabidopsis Actin2.
5
Evaluating SMC-Related Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To SMC-related gene expression evaluation, real-time RT-PCR was performed for alpha-smooth muscle actin (ASMA), smooth muscle 22 alpha (SM-22a), Caldesmon1, and Calponin1 in the SMC-differentiated cells on the scaffolds and cell culture plate as a control. First, total RNA of the samples was extracted by total RNA Prep kit (Biofact, Daejeon, South Korea) and then complementary DNA (cDNA) was synthesized by cDNA synthesis kit (Biofact, Daejeon, South Korea) according to the kit protocol. Then, real-time RT-PCR was carried out by prepared cDNAs for each sample (5 μg/ml), injectable water, primers (Table.1 ), and 2X real-time PCR master mix (SYBR Green, Biofact, Daejeon, South Korea) using the ABI StepOnePlus thermal cycler (Applied Biosystems, Foster City, CA).
Primer sequences used in real-time RT-PCR analysis at this study
| Gene | Primer sequences (5′→3′) |
|---|---|
| β-actin | GTCCTCTCCCAAGTCCACAC |
| GGGAGACCAAAAGCCTTCAT | |
| αSMA | GACGCACAACTGGCATC |
| GCAGTAGTAACGAAGAATAGC | |
| Calponin1 | ATGTCCTCTGCTCACTTCAAC |
| GCTGGTGGTCATACTTCTGG | |
| SM22a | GVAGTVVAAAATTGAGA |
| CTGTTGCTGCCCATTTGAAG | |
| Caldesmon1 | AGACTACAAGGTATCATTGGAAC |
| GACAGGTCAGCAATCAGATG |
6
Characterizing Pancreatic Islet Cell Differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of pancreatic and duodenal homeobox 1 (PDX1),
musculoaponeurotic fibrosarcoma oncogene homolog A (MAF-A), Nk class of
homeodomain-encoding genes 6.1 and 2.2 (NKX6-1 and
NKX2.2), Glucose transporter 2 (GlUT-2) and
INSULIN genes were evaluated which provide further evidence of ISCs
differentiation and maturation. The autophagic activity was also determined by evaluating
the expression of ATG-5, BECLIN-1, mTOR, and ATG-7genes. The GAPDH gene expression was detected as a housekeeping gene. RNA
extraction was performed by using the RNeasy Mini kit (Cat number: 74904, Qiagen,
Germany). Then extracted RNA were converted to cDNA by cDNA synthesis kit (Cat number:
205311, Qiagen, Germany). For each reaction, a mixture of 10 µL master mix Sybr Green (Cat
number: DQ384-40h, Biofact, Korea), 7 µL nuclease-free water, one µL of each sense and
antisense primers (Table 1 ) and one µL cDNA, was used. Real-time RT-PCR were run with the
following program 10 minutes at 95˚C, over 45 cycles at 25 seconds at 95˚C, 50 seconds at
5˚C, and 45 seconds at 60˚C. Finally, the 2-ΔΔCT value was used for data
analysis.
musculoaponeurotic fibrosarcoma oncogene homolog A (MAF-A), Nk class of
homeodomain-encoding genes 6.1 and 2.2 (NKX6-1 and
NKX2.2), Glucose transporter 2 (GlUT-2) and
INSULIN genes were evaluated which provide further evidence of ISCs
differentiation and maturation. The autophagic activity was also determined by evaluating
the expression of ATG-5, BECLIN-1, mTOR, and ATG-7genes. The GAPDH gene expression was detected as a housekeeping gene. RNA
extraction was performed by using the RNeasy Mini kit (Cat number: 74904, Qiagen,
Germany). Then extracted RNA were converted to cDNA by cDNA synthesis kit (Cat number:
205311, Qiagen, Germany). For each reaction, a mixture of 10 µL master mix Sybr Green (Cat
number: DQ384-40h, Biofact, Korea), 7 µL nuclease-free water, one µL of each sense and
antisense primers (
following program 10 minutes at 95˚C, over 45 cycles at 25 seconds at 95˚C, 50 seconds at
5˚C, and 45 seconds at 60˚C. Finally, the 2-ΔΔCT value was used for data
analysis.
7
Evaluation of SMC Differentiation Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To SMC related gene markers evaluation, on days 7 and 14 after differentiation induction, cells were detached from the scaffolds and TCPS and then their total RNA content was extracted using a total RNA Prep kit (Biofact, Daejeon, South Korea). After that RNA concentration was detected using the Nanodrop instrument (Nanodrop Technologies, Wilmington, DE), and then certain volume of RNA was used for complementary DNA (cDNA) synthesizing using a cDNA synthesis kit (Biofact, Daejeon, South Korea). Finally, real time RT-PCR procedure was initiated by mixing of the certain volumes of injectable Water, SMC and internal control genes primers (Table 1 ) and 2X real-time PCR master mix (for SYBR Green, Biofact, Daejeon, South Korea) in a 0.2 mL micro tubes and placing on the ABI StepOnePlus thermal cycler (Applied Biosystems, Foster city, CA).
The primers of the SMC related gene markers and an internal control gene that used in the real-time RT-PCR analysis at this study
| Gene | Primer sequences (5 → 3) |
|---|---|
| β-actin | GTCCTCTCCCAAGTCCACAC |
| GGGAGACCAAAAGCCTTCAT | |
| αSMA | GACGCACAACTGGCATC |
| GCAGTAGTAACGAAGAATAGC | |
| SM22a | GVAGTVVAAAATTGAGA |
| CTGTTGCTGCCCATTTGAAG | |
| Caldesmon1 | AGACTACAAGGTATCATTGGAAC |
| GACAGGTCAGCAATCAGATG | |
| Collagen-I-α1 | GCCAAGGGTCTGACTGG |
| CCCATCACACCAGCCTG | |
| Collagen-III-α1 | CCAGGTGCTGATGGTGTC |
| ACCTCTCTCACCAGGGCT | |
| MHC | CAACCTGAGGGAGCGGTACTT |
| GAGTAGATGGGCAGGTGTTTATAGG |
8
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) was utilized to extract total RNA from tissue samples. Thermo ND-1000 ultramicro nucleic acid protein meter (OD 260 nm; Thermo, Waltham, MA) and agarose gel electrophoresis were applied to assess RNA quantity. The amount of 9 µl of total RNA was used for quantitative real-time PCR (qRT-PCR). cDNA was constructed using a Transcriptor First Strand cDNA Synthesis Kit (Biofact, Korea). Real-time PCR analyses were performed with SYBR Green (Biofact, Korea), using the Rotor gene 6000 system, under the following conditions: (a) 95°C for 10 minutes; (b) 40 cycles of 95°C for 20 seconds and 56°C for 30 seconds; and (c) 72°C for 30 seconds. The relative gene expression was estimated by using the 2 - ΔΔCt method normalized to GAPDH. Each tissue sample was investigated in triplicate to obtain reliable outcomes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!